Transcript

pax6a-208

ID
ZDB-TSCRIPT-110325-845
Name
pax6a-208
Previous Names
  • pax6a-008
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050919 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050919|OTTDARG00000018854|ZDB-GENE-990415-200 pax6a|OTTDARP00000039990 pax6a-008 LG_none BX004784.9,AL929172.7 Danio rerio protein_coding KNOWN, 911 bp
AAGACAAATGTCAGGCAGGCTCATCATATTTTCCCCCTCT
TCTATATTTGGAGCTTATTTATTGCAAAGGAGCTTGTGCT
CTTGGACTCAATTTAACGCGAGGCTTCGGAGAGAAGGGAG
CTGAGAAGTAAAGCAAACCGGGAAGGCTGCTTATTCGTTT
TGGCTTCAGGTCACAGTGGAGTGAACCAGCTCGGCGGTGT
GTTCGTCAACGGCAGACCGCTACCCGACTCCACGAGACAG
AAAATAGTTGAACTCGCACACAGTGGCGCGCGGCCGTGTG
ACATATCAAGAATTCTGCAGGTGTCCAACGGCTGCGTGAG
TAAAATCTTGGGTAGATACTATGAAACAGGCTCCATCAGA
CCCAGGGCGATCGGAGGAAGTAAACCACGAGTAGCGACTC
CCGAGGTGGTCGGCAAAATTGCCCAGTACAAGAGGGAGTG
TCCGTCAATCTTCGCGTGGGAAATCCGAGACAGGCTGCTA
TCAGAGGGGGTCTGCACAAACGATAATATACCCAGTGTGT
CATCGATAAACAGAGTACTGCGCAACCTGGCTAGCGAAAA
GCAACAGATGGGCGCAGATGGCATGTATGAAAAGCTGAGG
ATGCTGAACGGTCAGACCGGCACGTGGGGGACCCGGCCGG
GCTGGTACCCCGGAACCTCGGTGCCAGGACAGCCCAATCA
AGATGGTTGCCAACAGTCAGACGGAGGCGGTGAGAACACA
AACTCAATAAGCTCCAATGGCGAGGACTCAGATGAGACCC
AAATGAGGCTTCAGCTTAAACGAAAACTGCAAAGGAATCG
CACTTCTTTCACACAAGAACAAATAGAAGCACTTGAAAAA
GAGTTTGAAAGAACGCACTACCCTGACGTTTTTGCACGAG
AAAGACTTGCTGCAAAAATAGATTTACCAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations