Transcript

pax6a-010

ID
ZDB-TSCRIPT-110325-2662
Name
pax6a-010
Previous Names
  • ottdart00000050924
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050924 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050924|OTTDARG00000018854|ZDB-GENE-990415-200 pax6a|no_translation pax6a-010 LG_none BX004784.9,AL929172.7 Danio rerio protein_coding KNOWN, 306 bp
GGACTCAATTTAACGCGAGGCTTCGGAGAGAAGGGAGCTG
AGAAGTAAAGCAAACCGGGAAGGCTGCTTATTCGTTTTGG
CTTCAGGTCACAGTGGAGTGAACCAGCTCGGCGGTGTGTT
CGTCAACGGCAGACCGCTACCCGACTCCACGAGACAGAAA
ATAGTTGAACTCGCACACAGTGGCGCGCGGCCGTGTGACA
TATCAAGAATTCTGCAGGTGAGGAGAATACCTGTGCTCCG
TTCACCCAAAATCAAAAGATTTGTTATTCATTTAAACTGT
TTCATACTTACATATTTTTTTCTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations