Transcript

pax6a-207

ID
ZDB-TSCRIPT-110325-2660
Name
pax6a-207
Previous Names
  • pax6a-005
  • ottdart00000050918
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050918 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050918|OTTDARG00000018854|ZDB-GENE-990415-200 pax6a|OTTDARP00000039989 pax6a-005 LG_none BX004784.9,AL929172.7 Danio rerio protein_coding KNOWN, 1922 bp
CGAGCGCACATTTTTCAGTCTCGCACAGTCTTGACATCCC
ATTTTATTGTCAATCTCTGTTTCCTTCGCAGGGAATTTAA
ATTTTCCACCCGAGATCAGTTGGAAACTATAAAAGACAAA
CTGTTTGAGGACGATTTTCTAGAACTCCAGAGTCTTCTCG
TTATTGTAAACGAAGAACTTCAGCGAGGATACAAAGGCTG
TTGGAACTATGCCTCAAAAAGGGATATTTTAATAGAGTGA
AGCAGATGACAGTCTATAAATTGTTTTAAGCGGACAGTCA
ACTCTGTTTCCAGAATACTATAACCGGGCCACGTGGGAGT
CTGGTGTCGCGTCCATGATGCAAAACAAGGTGTATGACAT
CTGTAACGAAGGTCACAGTGGAGTGAACCAGCTCGGCGGT
GTGTTCGTCAACGGCAGACCGCTACCCGACTCCACGAGAC
AGAAAATAGTTGAACTCGCACACAGTGGCGCGCGGCCGTG
TGACATATCAAGAATTCTGCAGACCCATGCTGATGCAAAA
GTCCAAGTGCTGGACAATGAAAACGTGTCCAACGGCTGCG
TGAGTAAAATCTTGGGTAGATACTATGAAACAGGCTCCAT
CAGACCCAGGGCGATCGGAGGAAGTAAACCACGAGTAGCG
ACTCCCGAGGTGGTCGGCAAAATTGCCCAGTACAAGAGGG
AGTGTCCGTCAATCTTCGCGTGGGAAATCCGAGACAGGCT
GCTATCAGAGGGGGTCTGCACAAACGATAATATACCCAGT
GTGTCATCGATAAACAGAGTACTGCGCAACCTGGCTAGCG
AAAAGCAACAGATGGGCGCAGATGGCATGTATGAAAAGCT
GAGGATGCTGAACGGTCAGACCGGCACGTGGGGGACCCGG
CCGGGCTGGTACCCCGGAACCTCGGTGCCAGGACAGCCCA
ATCAAGATGGTTGCCAACAGTCAGACGGAGGCGGTGAGAA
CACAAACTCAATAAGCTCCAATGGCGAGGACTCAGATGAG
ACCCAAATGAGGCTTCAGCTTAAACGAAAACTGCAAAGGA
ATCGCACTTCTTTCACACAAGAACAAATAGAAGCACTTGA
AAAAGAGTTTGAAAGAACGCACTACCCTGACGTTTTTGCA
CGAGAAAGACTTGCTGCAAAAATAGATTTACCAGAAGCAA
GAATACAGGTCTGGTTCTCAAACAGAAGAGCGAAATGGAG
GAGGGAGGAAAAGTTAAGAAATCAAAGAAGACAAGCCAGT
AATTCCTCAAGTCACATACCCATCAGCAGCAGCTTCAGCA
CAAGTGTCTATCAACCAATCCCTCAGCCCACAACGCCAGT
ATCCTTTACGTCAGGCTCCATGTTGGGCAGATCAGACACA
GCTCTTACGAACACATACAGCGCCCTGCCACCAATGCCAA
GCTTCACCATGGCCAACAACCTTCCTATGCAACCCAGCCA
GACCTCATCCTACTCCTGCATGTTGCCCACTAGTCCTTCA
GTAAACGGGCGGAGCTATGACACATACACACCCCCGCACA
TGCAGGCGCATATGAACAGCCAATCAATGGCCGCCTCGGG
CACAACCTCAACGGGTTTAATCTCACCTGGAGTGTCTGTA
CCCGTTCAAGTGCCAGGCAGTGAACCAGACATGTCCCAAT
ACTGGCCCAGACTACAGTGAGAACGCGACGCACAAGAACA
AAAAAGGAAATCAGAGGAGAGAAAAAAAAAAAAAGAGAAG
CTCCTTCACCTCCTGATGTCTCTCGGCTACAAGACAGGGG
TGTTCAGCAGTATTTCACCACAGAAGGAAAGGAGGAGACT
CTAAAGGACCTCTTTTTTTGTACGGGGATAGTGCCACTTC
TCTATCATTCTTTGGACACAAAGACTTGAAGAATAAAAGA
GAACAGACTTCTGTAAAGTGCCCGGTATTATATCGTAAAA
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations