header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-670
Transcript Name: tcf25-005
Previous Name: ch211-132f3.1-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050130 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050130|OTTDARG00000017788|ZDB-GENE-040905-2 tcf25|no_translation CH211-132F3.1-005 LG_none CR936382.9,CR457484.9 Danio rerio protein_coding KNOWN, 673 bp
GATAGGAGAGGCTGATGTGGAAGCATGTCTGTCAGATGTG
GAACAGGCAGAAAAAAACAGTGATGGACAACAAGAAGCTC
ATCTGGGGAAAGATGCTGAAAAGAAAGAGAAATCAAACAA
AAAGAAGAAGAAGAAGAAGAAAAATAAGGATTCAGCTATA
AGCGTAATATAATATATAGAGTTTAATTTTTATGTTTGTA
TTATTTGGGTTTTTTACCAAATCTAGTTTAATTCCATGTC
AACAGCTCCTTTAGAAATATTTTTTCCAGAAAAAAAAAAA
ACATGACGTATTCAATGGTTATTTCTCCCACTGTAAATAT
AAACTCTAAAGCATAAAAACAGCATAATATGTATTCAGAT
ATGTAAGAAACACCTAAGAAACAGCTAAACAACAGCTAAG
TAATATTGTTAATTTGAAAATACTAATGCTAAATGTCAGT
TATTCTTTGTTCCTCTAAACCACAACGTATGTCATTTTAG
TCTTGAAGGCTGTATAAGTGTGTGGGGGTGGCTAAATATG
CAACCTCAAGAGGACAGTAGCAGCCTTCAAGATGAGATAT
AGATTCAGAGTTGGGCTTTTACATAAGGTGGCTTTTAATT
AGCAGATAATATACATATGACAAGCGTAAACATTATGGCA
GTAAATGTCTAACCATATGCAAAATATATGATT

tcf25 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tcf25-004 (1) 2326
tcf25-005 673
tcf25-006 (1) 536
mRNA tcf25-202 (1) 2184
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tcf25-005 Contained in:
OTHER tcf25-005 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050130 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH541656 (1) 943bp
    CITATIONS (1)