header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5118
Transcript Name: tcf25-202
Previous Name: tcf25-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021437 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021437|OTTDARG00000017788|ZDB-GENE-040905-2 tcf25|OTTDARP00000018050 CH211-132F3.1-002 LG_none CR936382.9,CR457484.9 Danio rerio protein_coding KNOWN, 2184 bp
ACGAAGAAGAAGACCAGGAAGGGGTAGAGGACTAGTAAGC
CTGTTTGTTTCAGTGCAAGTTTGTGAAACGAGTGCGCTAG
TTCCTATGGGCTAGATTCGTGGTTATTGATAAGTTGTGCT
GACGTCCAACATGTCGAGTCGCGCTCTACGTAGGCTGAAG
GGCGAACAACGCGCTCAGGCCGTGTTACAAGAGCACGAGC
TTATTAAGGAAGATGACAAAGATGAAGAAGAGCAGATGAA
GATTGCCGAACAAACAACCCGTAAACCGAGGAACTTCAGC
AGCTTATTTGAACTGATAGGAGAGGCTGATGTGGAAGCAT
GTCTGTCAGATGTGGAACAGGCAGAAAAAAACAGTGATGG
ACAACAAGAAGCTCATCTGGGGAAAGATGCTGAAAAGAAA
GAGAAATCAAACAAAAAGAAGAAGAAGAAGAAGAAAAATA
AGGATTCAGCTATAAGCGATGATTTTGGCACCGAAGATGG
TATTGATGCTCTATTAGAAATTCCTGAGAAGAGCAAAGGC
TTGTCTTGTCAAAGTGCTGAGAATAGTGCTTCTGAACGCA
GACCCGTACTGTATGTTGAACACAGGAATTTGAATTCAGA
GACAGAGCTGAAGAGGTTTTTTGGAGCACGGGCTGTTCTT
GGACACCAGAGATCAAAACAGAGGCAGAGACAGTTTCATC
GATGCACTTGGATGACTGTTTTTAAAGACACTTGGCCCCG
CTTTAGTCGACCAGGTATCTCAATGAGTCTAGTGGAGTCT
AAAGATGGAGTTCAGCATTTCACATTTGAACATAATCATG
ACTATCAGCAAGTTCAGTTCAAGTTTTTTGAGGTGGTGGA
GTCAATGGACCCTAATAACATTGTGGTTCTCCTACAGATC
AACCCATATCATATCGATTCACTTTTGCAGCTGTCAGATG
TATGTCGTATGCAGGAAGATCAAGAGACTGCCAGAGATCT
CATTGAAAGGGCTTTGTACAGTTTTGAGTGTGCATTCCAC
CCTGTGTTCAGCTTAACATCAGGCACGTGTCGGCTGGACT
ACTGCAGACCAGAGAACAGGGGTTTTTATTTGGCACTGTT
CAAGCACATACAATTTCTGGAGAAGAGAGGTTGTCCCCGC
ACAGCCCTGGAGTACTGTAAACTGATTCTGAGTCTGGACC
CAGAAAATGACCCCCTCTGTATGCTGCTTTTCTTTGACTT
CCTCTGCTTGCGTTGTCATGAGTACAGCACTCTTATTCGA
CTCTATGAGGAGTGGGAGGTCCATCGAAATCTTTCCCAGC
TGCCAAACTTTTCATTTTCTGTGGCTCTTTCCTATTTTCA
TCTGAGCCAAGATGAAGACATTTCAACTGTGGAGAGCCAA
CAACTAAAGCAAAAGTCCAATGTGCTACTGCAAAATGCTC
TCATCATGTTTCCTGGGGCACTGATGCCACTTTTGGACTT
ATGCACAGTTCACCTGGAGGCTGCGGTGTCTTCTCACATA
TTCTTTGGACCTTCAAGTCAAATCGAACAGCCACCTGCAC
TTTCTGAGTTGGTGTCCCTATATGTGGGCCGGTGTCATAG
CCTGTGGAAAGAGGCTGGAGTAATGGACTGGTTGGAAGAG
AATGTCAGAGAAGTGCTAAAAAGAGTTGACACACATGACC
CTTTTGTAGAAGACTGCCAAAACAAGAGGAAGCAGAGATA
CCAGAGTGCTCCCAGGAACATCCATAGGCATGTGCTGTTG
TCTGAGATTAAGGAGGCAACAGCTACTCTTCCACTAGAAG
TGACCACTCAGCCAGGAATGGGATTTGACCCTCTTCCTCC
TCTGAACTCCATTGTGTCTTACACCAGACCAGAAAGGCAG
AGCATGGGGGCTTCAAATGAAAGCACATTTTCTTTGTTTT
TCCGTTCATTGCTACCAAACTTCAACCTACAGAGGCCTGA
AGAAAGACAGGATGTTGCCCGTGCTGGTGAACTAAATCAA
GAAGTTAACAGACTCATGGTTGCCATGAGGGACATGTTGG
CTAACATCCAGTTTCATGAACCTCAGTGGGAGGACAACCA
AGACAGAGACGAGGAGGAATGGGACTAACAGATTAACAAG
GTTGTGATTTTTCAAATGAAGTTGAATGACAAATTGAAAA
AGCACAAAAGAGGAATTTGTATGATCTGCTCACCTTAATT
TTGAATAAATCCAAATTATTCATA

tcf25 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tcf25-004 (1) 2326
tcf25-005 (1) 673
tcf25-006 (1) 536
mRNA tcf25-202 2184
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tcf25-202 Contained in:
OTHER tcf25-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021437 (1)
  • Ensembl_Trans:ENSDART00000138403 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE712324 (1) 924bp
    GenBank:CT642839 (1) 685bp
    GenBank:EV606294 (1) 664bp
    GenBank:BQ450281 (1) 645bp
    GenBank:BM182516 (1) 641bp
    GenBank:BQ450467 (1) 589bp
    GenBank:BQ450448 (1) 499bp
    GenBank:EH561969 (1) 420bp
    GenBank:BI710043 (1) 394bp
    GenBank:BQ450261 (1) 358bp
    CITATIONS (2)