Transcript

ghsra-202

ID
ZDB-TSCRIPT-110325-666
Name
ghsra-202
Previous Names
  • ghsra-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050118 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050118|OTTDARG00000024577|ZDB-GENE-070912-238 ghsra|OTTDARP00000039338 ghsra-002 LG_ CR848726.7 Danio rerio protein_coding KNOWN, 892 bp
ATGCCTACCTGGACGAACCGGTCCAACTGTTCCTTCAACT
GCAGTTGGGATGATAACGCGACATACTGGGGGATCGAGCA
GCCGGTCAACATCTTCCCCATTCCAGTGCTAACCGGGGTC
ACCGTCACCTGTGTGCTCTTCTTCTTTGTAGGGGTAACGG
GCAATCTGATGACCATTTTAGTGGTGACCAAATACAAGGA
CATGAGAACAACCACCAACCTGTACCTGTCCAGCATGGCC
TTTTCGGATTTACTCATTTTCCTCTGCATGCCCCTGGACC
TGTACAGAATCTGGAGGTACCGACCTTGGAATTTTGGCAA
CATACTTTGTAAACTCTTTCAGTTTGTGAGCGAGTGCTGC
ACATACTCGACCATTCTGAACATCACAGCTCTCAGTGTGG
AGAGATACTTTGCTATTTGTTTTCCTCTTAGGGCAAAGGT
AGTCGTGACCAAGGGTCGAGTGCGAGGGGTCATTTTGGTC
CTATGGATATCTCATCGGGCGAAAGCTCTGGAAGAGAAAG
AGGGAGACGATTGGAGAAAACGCTTCGAGTCGAGATAAAA
GCAATAGACAGACAGTGAAAATGCTGGCTGTGGTGGTGTT
TGCCTTCGTGCTTTGCTGGCTCCCCTTTCACGTGGGTCGT
TACCTGATCTCCAAATCCACAGAGATGGGCTCTCCTGTCA
TGTCCATCATCAGCCACTACTGTAATCTCATCTCCTTTGT
ACTCTTTTACCTCAGTGCAGCAATCAACCCCATTCTGTAC
AACATCATGTCCAAGAAGTACAGGATGGCAGCTTGCAAAC
TTTTTGGACTACGTAACATCCCGCGAAGAAGCACATCGGT
TGCCAAAGGAGAGAGTTCGCCATGCTGGACGGAATCTACA
GCCAGCCTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations