Transcript

ghsra-201

ID
ZDB-TSCRIPT-090929-13721
Name
ghsra-201
Previous Names
  • ghsra-001
  • si:ch211-244m8.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032185 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032185|OTTDARG00000024577|ZDB-GENE-070912-238 ghsra|OTTDARP00000026114 ghsra-001 LG_ CR848726.7 Danio rerio protein_coding KNOWN, 1108 bp
TCTAGACGCTCCATGATCTCTCAGCATGCCTACCTGGACG
AACCGGTCCAACTGTTCCTTCAACTGCAGTTGGGATGATA
ACGCGACATACTGGGGGATCGAGCAGCCGGTCAACATCTT
CCCCATTCCAGTGCTAACCGGGGTCACCGTCACCTGTGTG
CTCTTCTTCTTTGTAGGGGTAACGGGCAATCTGATGACCA
TTTTAGTGGTGACCAAATACAAGGACATGAGAACAACCAC
CAACCTGTACCTGTCCAGCATGGCCTTTTCGGATTTACTC
ATTTTCCTCTGCATGCCCCTGGACCTGTACAGAATCTGGA
GGTACCGACCTTGGAATTTTGGCAACATACTTTGTAAACT
CTTTCAGTTTGTGAGCGAGTGCTGCACATACTCGACCATT
CTGAACATCACAGCTCTCAGTGTGGAGAGATACTTTGCTA
TTTGTTTTCCTCTTAGGGCAAAGGTAGTCGTGACCAAGGG
TCGAGTGCGAGGGGTCATTTTGGTCCTATGGATAGTATCC
TTCTTTAGCGCGGGACCTGTGTTCGTGCTCGTCGGGGTTG
AGCACGAAAACGGGACTAACTCGTGGGATACCAACGAATG
CAAAGCGACGGAATATGCCATCAGGTCTGGGCTCTTAACC
ATAATGGTTTGGGTCTCCAGCATCTTTTTCTTCTTGCCTG
TGTTCTGCTTAACTGTCTTGTATAGTCTCATCGGGCGAAA
GCTCTGGAAGAGAAAGAGGGAGACGATTGGAGAAAACGCT
TCGAGTCGAGATAAAAGCAATAGACAGACAGTGAAAATGC
TGGCTGTGGTGGTGTTTGCCTTCGTGCTTTGCTGGCTCCC
CTTTCACGTGGGTCGTTACCTGATCTCCAAATCCACAGAG
ATGGGCTCTCCTGTCATGTCCATCATCAGCCACTACTGTA
ATCTCATCTCCTTTGTACTCTTTTACCTCAGTGCAGCAAT
CAACCCCATTCTGTACAACATCATGTCCAAGAAGTACAGG
ATGGCAGCTTGCAAACTTTTTGGACTACGTAACATCCCGC
GAAGAAGCACATCGGTTGCCAAAGGAGAGAGTTCGCCATG
CTGGACGGAATCTACAGCCAGCCTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations