Transcript

ctbp2a-211

ID
ZDB-TSCRIPT-110325-611
Name
ctbp2a-211
Previous Names
  • ctbp2-010
  • ctbp2a-010
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049832 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049832|OTTDARG00000035060|ZDB-GENE-010130-2 ctbp2a|OTTDARP00000039098 ctbp2-010 LG_ CU459182.11 Danio rerio protein_coding KNOWN, 765 bp
GTGATGCTGGATCTCTTCATTTGCCGAGCTCTGCAGGCAT
TGCTGGCCCATCATAGGATTATTGTTCAATCAGGATTTGA
CGTTTCCTGACAGTGCTACATGATTTTGCCCTGCTGCATT
AGATCTGTATTAGTTTCACTGGCCCGCCTCTTGGGGCCCA
CCTCTTGGAATCAAGCAAAGACCTTCAGCTCAGTGCCAGC
TGGCCAGGCCTTTGAAAGACTTACAGACCACCTTGAGCAC
TGGCATATTCAGGTATAAGGCCTCAGATCATGAATGGCCC
CATGCACCCCCGGCCGCTGGTGGCTCTGCTGGACGGGAGA
GACTGTACTGTGGAGATGCCCATCCTAAAGGATTTGGCAA
CCGTGGCGTTTTGTGATGCACAGTCCACGCAGGAAATCCA
TGAGAAGGTGTTGAACGAGGCGGTGGGTGCGATGATGTAC
CACACCATCACCCTGACCAGAGAAGACCTGGAAAAGTTCA
AAGCCCTCCGGATTATCATCCGCATCGGCAGTGGATACGA
CAACATCGACATTAAAGCTGCCGGAGAGATGGGTATTGCG
GTGTGTAATATTCCGTCGGCTGCGGTGGAGGAGACGGCGG
ACTCGACGCTCTGCCACATCTTGAATCTCTACCGCAGGAA
CACGTGGCTGTATCAGGCCATGCGGGAAGGCACACGGGTG
CAGAGCGTGGAGCAGATCAGAGAGGTGGCGTCAGGAGCCG
CACGAATCAGAGGAGAGACGCTCGGACTCATCGGCTTCGG
TCAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations