Transcript

ctbp2a-207

ID
ZDB-TSCRIPT-110325-609
Name
ctbp2a-207
Previous Names
  • ctbp2-001
  • ctbp2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049826 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049826|OTTDARG00000035060|ZDB-GENE-010130-2 ctbp2a|OTTDARP00000039092 ctbp2-001 LG_ CU459182.11 Danio rerio protein_coding KNOWN, 2877 bp
GAAAACAGAGACATCTCAATCCTTGCAACTGGGGAAAAGA
TGAAACGTAGTGCACCATAGTCCTCGAATCACCTCCTCTT
TTATTTATTTTTTTTTAAACCCAGTAAACCACCTCCAGGC
GCTCAGAACCAGAACTGAGCCACATCTGTGTATGGTGGCG
TTATGCCCACTGGAGGATACTGGGAGCTGTAGTTTCCTAA
GCTCTACAAACAGACGCTGAGAAAAGCTGTCATGGCTTTG
ATTGATAAACACAAGGTCAAACGGCAAAGACTAGACAGAA
TCTGCGAAGGTATAAGGCCTCAGATCATGAATGGCCCCAT
GCACCCCCGGCCGCTGGTGGCTCTGCTGGACGGGAGAGAC
TGTACTGTGGAGATGCCCATCCTAAAGGATTTGGCAACCG
TGGCGTTTTGTGATGCACAGTCCACGCAGGAAATCCATGA
GAAGGTGTTGAACGAGGCGGTGGGTGCGATGATGTACCAC
ACCATCACCCTGACCAGAGAAGACCTGGAAAAGTTCAAAG
CCCTCCGGATTATCATCCGCATCGGCAGTGGATACGACAA
CATCGACATTAAAGCTGCCGGAGAGATGGGTATTGCGGTG
TGTAATATTCCGTCGGCTGCGGTGGAGGAGACGGCGGACT
CGACGCTCTGCCACATCTTGAATCTCTACCGCAGGAACAC
GTGGCTGTATCAGGCCATGCGGGAAGGCACACGGGTGCAG
AGCGTGGAGCAGATCAGAGAGGTGGCGTCAGGAGCCGCAC
GAATCAGAGGAGAGACGCTCGGACTCATCGGCTTCGGTCG
ATCGGGGCAGGCAGTGGCAGTTCGAGCGAAAGCGTTTGGC
TTTAATGTGATCTTTTACGACCCGTATCTGCAAGACGGAT
TAGAGCGATCGCTGGGCGTGCAGAGAGTTTACACCTTACA
GGACCTGCTGTACCAGAGCGACTGTGTGTCTCTGCACTGC
AACCTGAACGAACACAACCATCACCTCATCAACGACTTCA
CCATCAAACAGATGCGACAGGGAGCGTTTCTCGTGAACAC
AGCTCGCGGTGGTCTGGTGGATGAGAAAGCTCTGGCTCAG
GCTCTGAAAGAGGGCAGGATACGCGGCGCTGCCCTGGACG
TTCATGAGTCTGAACCCTTCAGTTTCACTCAGGGTCCTCT
GAAGGACGCGCCCAATCTGATCTGCACCCCTCACACAGCC
TGGTACAGTGAGCAGGCCTCACTAGAGATGAGAGAGGCAG
CAGCCACCGAGATCCGCAGAGCCATCACCGGTCGTATTCC
AGACAGTCTCAGAAACTGCGTCAACAAAGAGTTTTTTGTG
ACTACGGCGCCGTGGGGGGTGATGGAGCAGCAGGTTCATC
CGGAGCTCAACGGCGGAGCCTACAGCAGAGTCGCCCAGCC
GCTCCCAGCCGTCTCTCCCGGCGGCCTGCAAGACAAAATG
TATACCTAAACAATGACAGGTTTCCTCCTGGAGCGGTGGG
TGTATCTCCTGGTGGCATGGGTGGACAAATAGAGGGCATG
ATGCCAGGCGGGCTGCCCAGCGCCCATCCCCTGCCGCCCG
GCACCCAGCCCAGCCTCGCCCCGTCGCCCACCCAGCTCCT
CAAACACAACGACCATAGAGAACACCTCGCCAAATCCTAA
CCAGTCATTCAGCAAAACTGCAAATCAAAGAGACTAAGAG
ACAGTGAAAAAGGGTGAACGAGCAATCAGCTGCACCGGAA
AACACACACACACACTTCACAGACGTCTCTCCACTGTCGT
CTTCAGCATTTTACTGTCCATTTCTGTCGTTCTGTGAAGG
GGAGGAGATTGTTTATATATGTTCCGATGCAGGTGGGCGG
TGCTTTTTTTTGCCAGAAGGGGGAGTGGCTAACTAACCAC
GCCTTCTTTTTTCCACAAAACTCGCGGTTCAAAATGTTGA
TCTCATACGCCACGCACTTCGTCTTCCTCCTCCAGGAAGA
AGAAACAGGACTCAATGTATTCAGTTATGCTTATTCTTTC
TTTACATCCACAGAATTAGTGCTCGTCTTTGTTTCAGTGT
TTAAAAAAAAGTGCTCGATAATAATTAAAATATATATAAA
TATACGGTGTATCTATTGAGAGAAGGGGCAGAAATGAAGA
TGATATTGTAACTATTAGCTTGTTTTCAGATGTTTTCGTA
GCTGATCTCGTTTACAGACTTGCACAAATTCAACAAGCAC
CAGCTCAGAAACCACTCCGTCTTTTAGAGCACACTATTTT
ACTGATCAATTCAATTCAGTGACTTGAAATGCAAACGTCA
GGTTTTTAAGATATATCAAGTTTTCCAGAAAAATAAATAA
ATGGCAATTTGGATTTGAGTGCATGTCACTGTTTGATTTC
ACTTTATTTTTGTGTCTGAAATCCCACTAAATTGATGGCA
GCTCACACAGAAAAAAAAGGGACTGGAGTGAAAAACCGCC
CCGTCTCAGGAAGAACATTCCCCGGTTACTCCACCACACA
CATCCAAATCCCATCGCTCCTTCCCATCAGCCTATACCCG
AGGTATTTTTATAGATCTGACATCATCCAGTGCGTTTTTT
TTGGTGTTGAATGTATGGCAGTTCAATTAGATTTGTATCG
TCTAGTTTAATGTTTTTTGTAATCATACTTTCCTGTGATC
CTCTCCCTGTTCCTATTATTTGATTTTGATTTGATTTTTG
GGGTTCTTTATGTGGAAGCGCACTGTTCGGAGCTCATCGT
GTTGTTTATATGCAATATTCTGAGATCCTCGGCCAACTCC
AGTCAGGTTGGCTCCAGAACTGTAGGTTTGGTTTTTAGTG
TGAGTATTTGTATTTGTTTATTGTACCGAGGTGAACATTT
AGCATACAGTACAGTTCAAATAAAAATACCATTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations