ZFIN ID: ZDB-TSCRIPT-110325-529
Transcript Name: pcf11-201
Previous Name: pcf11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049485 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049485|OTTDARG00000034858|ZDB-GENE-041114-175 pcf11|OTTDARP00000038817 pcf11-001 LG_ CU928848.11 Danio rerio protein_coding KNOWN, 4971 bp
CATTTTGCAAAGCGCAGTTGAAGCAACATCGTCAGCTACA
CAAAAGCAAGACGCGAGGAGATTCGGCACAGCATTCGACG
CACAGAGGGAACTAAAAGGAAATACAGATGTTTAAGTGGA
CTGTGTTGCGAGTTATGTTTGTATAAAAGTTTAATTTGTG
TGGCGACTCAACGGCTCAAAGATGTCGGACGACGGTGCGA
GGGAGGACGCCTGCCGCGAGTATCAGTCCTCGCTGGAAGA
TCTGACTTTCAACAGCAAACCGCACATCAACATGCTCACC
ATTCTAGCCGAGGAAAACATCCAGTTCACCAAGGATATCG
TCGCAATAATTGAAGCACAAATTGCCAAGGCACCTCCTGT
TGAGAAGCTTCCAGTTTTGTACTTAGTGGATTCCATAGTG
AAGAATGTTGGAGGGGCTTACCTTGAAGTGTTTGCTAAGA
ACCTAGTCAATTCCTTTATTTGTGTATTTGAAAAGGTTGA
TGAGGGCACTAGAAAAAGTCTCTTCAAATTGCGTTCTACA
TGGGATGAAATTTTCCCCTTGAAGAAACTATATGCACTTG
ATGTGCGTGTGAACTCTGTAGATCCTGCATGGCCCATTAA
ACCATTGCCACCAAATGTGAATGCCAGCATTCATGTCAAC
CCCAAATTTTTAAAACCGACTGAAGAAACGCCCCCGAAGC
CTACACCACCACCTCCAACACCAAGCTTGACTCAAGAGCA
GCTGATAAGGCAACAGTTGCTTGCAAAGCAAAAGCAGTTG
TTAGAACTTCAGCAAAAGAAGATAGAGCTTGAACTTGAAC
AAACAAAAGCTCAGTTGGCTGCCAGTCCATCTCTGGCTTT
AAATCATCATGCCAGTGCTCCAGTCCGTTTCAATGCCTCA
CCAAAGGTTAATCCAACGGTTCCTGTTCCGCAGACCAAAT
CTTGGCCTCCTGCCCCATCAGAAAAATTGTCAACCAGAGA
TCCTAGATTAAACAGATCTGGTACAACAGCTGTAAATCCA
AAAGAACAAGTGACGCATAAAAAGGAGAGTCCAGCTGCAC
CAAGCTTTCAAAATGCTCCAGAAAAAAGAGGACAAGCCTC
ATCTGAAAGACCGGCTAAGTTGGATAAGTTGAGAATTCCA
AAAAAGGATAACTCTGCTGTTGAAGAAAAGTCTAAATCCA
AGTCTATGTTGCCATCTGGAAAAGTGATGCCTGTAAGACC
TAGAGGATTGGAGTCTGAACAATCTAAGTCTGCTGAAGTC
AACAAAAAGGACCCAAGGCTACATAAGCAGATGCATGAAA
GGATGGATTCAAAAGATGAAGATGTTCGAGAGAAGAAAAG
AAGCTCAGAGAAAAAAGATAGGGATGAAGGTTCCAAAAAT
TTGGATCATCAGAAGTTAAGCAGCAACAGAGGCAAACTTA
TAAATGGCTCTGTGAACAAGCATGAAAAGCTAGAGACCTT
TCTGAAACAGGAGATCAAAGTGAACAAAGCAAATGTTAGA
AAAAGGTCAAGATCGCGTTCTCCACCCGTACATTCTCCTA
AAAGAAAAGAGAGGCGATCGTCTCCAAAGAGAAAAACCAG
GAGCATTAGTCCACCTCCCAAGTCTGGAAAGTCTAGACTC
AGTAAGCATCCACATGATGATGCTTTCCCACAACCAAGTG
CAAGAGATGAACGTACAAAGAAAAGTGTTCCTGATTCGAG
ACGACCAAAAAGGCCTCTTGAGGATAGACCTGCTGAAAAG
AAAGATGGATCACTGCAAAGAATTTCTGCTGCAGAGCATA
AAGATCTAAAAGATGGCAAGAGGTGGAGGAGTGGATGGGA
AGAAAACAAACATCCTAAACACTCAGATACAGATCTGTCA
CATGGGCGAATGGGGATCCAGAAACACAAAACTTGGAACA
CTAATCAAAGACCACCCACACCTCGGACACCTAAGCAACA
TCGCTTAAGTGTTGATAGCAACATACAAATACCAGAAGCA
CTGCATTCTGCTAGTAAACGGGATCTTTTAAGAAAGGCTA
GCAAAAGGCGTGCTGATGGCGAAATATCCAATGATGAATT
TCTCAGCGTAGCTCATCAAATCAACCAACTTTTTCAATAT
CAAGAAGAAAGGCAACGATCAGATTCTTGGGATGAATCAT
GTGATGAGGGAGTGTATCCATCAAGAAAGAAACAAGAAAC
CATATCTGATGCTTACCTTGAGCATAAATTAAAGTTGAGA
AGAACTCAGCTCCACCGTCCAGTGCAAAGAGGGGGACATT
TACCTTTGCATGAAATGTATCACTATCCGCCTCATCATGA
AGTATCTGAACAATATAGTGAAAGCTTGGATGTGCATAAA
ATGTCAGGTGATCCCATAAAGCCACTCTCTGACCATGAAG
ATCACAGAAGAATTGACAGGCCTCCATCCTGCACAGGGTC
TACTTTCAGAAATTCGCCAAGCCCAGTTGGCTTAGATGGT
ATCTGTGGAAAATCCACAGTACTTCCATTTGAACGGCCAT
CCTCACCATCTGAAATGGATCAACAACCTGAGGGAGACAT
CAGCCCACGTTTTGAAAGTCCCAACAGTGTGCACTCTGGC
ACAGGCCCAGATGATGGTCCAATTAGCGTTGAGGGTCTTC
CCAGGCACGATCATTTCTTGGAACAAGGACGAAGTGGGCG
AATCCATGGTGAATCACCTGGAAATACACCAAGTCACTCA
GAAGGACCTACAACGCAGGTCAATGCAGCACGGCATGATG
GACCAATTCATCAACGTTTTGATAGGTACAAAAATCCTCA
GGCTCCCTTTGATGGACCATCTAGCCACATGAGAGAGCCA
AGATTGGATGGACCTCCAAGACCATTTGTTCCACCTTCAC
GATATGAAAGCAATACAGGGGGATTTGATGGGTCAGGTGG
ACCTGTAAGGTTTTCCGGACACCGCTTTGATACCCCTCAC
CACTTTGAACAATTTCCCAAAGCACCTGAAAGACCTGTGA
GATTTAACAACCCACAAGTTTCACATAGGCCAATGCGCTT
CGTAGAGCCTCATAATGTTAGATTTGACTCCCCAACACCG
GTTCATTATGATCACTCAATGCCCCAAAACAGATTTGTTA
ATCCACCAAGGTTCGATAACCCTCAAATGCAACAGGGCCC
ACCAGGATATGAGGAACCACATTTTCCAGCTAGGATAATT
AATTATGATGAACAGCAGGGTCCAGTTAGATTTGATAACC
CAACATGTGGGATTCGTTTTGAGAACCCTGTGCAGCCTGA
ACCCTTAAGGTTCGATGCACCACCTGTCATGCCAAGATAT
GACCCACAGGGCCCTCCAAGATACTGCGGTCCAAATATTC
CAAACCAGCTAAGACCACAGGAACCAACAATGTATGATCA
AACTCAAGGTCAAGGTCCAATGATAAACCCTACTGTACCC
CCACCCAATTTCAACATGCCACCCATAAACTCATTTGGTG
GTCCAGCCCAGCAGTTTTCCATGCAGCAAAATGTCTCGCA
AACCTCCAACTTCAGTGTGCCAGTTCCTACATCATCAGAT
TTTCAGGGTTCATTTAGACCTCCATTCCCTGGTCCGGGTG
TCGGAGGTGTTCCTCAGCCTATGATGGGTGCTCAAAACTT
CATGCCCCAAAATCCAATGCCTTTTCAGCCAGTCTCCCAA
TTTCCACAGCCTGAGCCAGAGCCATTGAGACAAATAGATG
TGAATGATCTGATGTCTAAGCTTATATCCACTGGAATTAT
TAAACCTGCACCTACAGACTCAACAGCTGACTCCCCATCA
GCTAGTCAGACTATATCTGTGCCTGAAGAAGAGGAGGAGG
AGGAGGAGCAAGAGCAAGAAGAAGATGACAGTGTCCCAGA
TTTGACTGGCTTTATTTTGGATGACATGAAACAGAGACAC
GAAAGCATTATCACTAAACTCTATACTGGAATCCAGTGCT
ATTCCTGTGGCATGCGTTTTACTGCATCTCAGACAGACGT
GTATGCAGATCATTTGGACTGGCACTACAGACAGAACCGC
TCAGAGAAAGACATCAGTAAGAAAGTCACGCATCGCCGCT
GGTACTACAGTCTGACGGATTGGATTGAATTTGAGGAAAT
CGCTGACCTTGAAGAGAGGGCAAAAAGTCAGTTCTTTGAA
AAAGTTCATGAAGAGGTTGTACAGAAAACTCAGGAGGCAG
CCAAAGAAAGGGAGTTCCAGAGCGTGAAGGCTGCAGCGGA
TGTCGTTCATGAGTTGTGCGAGATTTGCCAGGAGCAGTTT
GAGATGTACTGGGAGGAGGAAGAGGAAGAGTGGCACCTGA
AGAATGCCATCAGAGTTGATGAAAAGACCTATCATCCCTC
ATGTTATGAAGACTACAAAAATACATCCTCCTTTATGGAC
ACCACACCCTCGCCCAATAAAATGCTTACAGAAAATCCCT
TAACAGCTTTTTTGAAACAAGAGCAGGATGACGAGACGTC
GTGTTCCAGTATTAAAGAAGAGCCCGCTGATGATGATACG
GAGGCTCCAATGGTAAAAGAGGAGGTTCAGGTTAAGTTAG
AAGGAGAATCACAAACCAGTGCAATTATTTTCTAACTATG
CTGCTCTTTAGCCACTTCTTTTGGTGGTTATTTAACTGGT
CCTTTGTGTTTTTGTAAAGAAGGATATTTTTATATTGCAG
AGCTCTGGGGCCGGGACCTCAGCTAGTCACTTTAAATACA
TTTTTGTATTTGTATTTGCCTGCACATTTCAGGTATTTTT
GCCATGTGAATGCCCAATGAAATGTACTGAAAAAGATGTG
CGTTTGGGGTATATGTATATGTATAATTTAATTTATAAAT
AAAGATATTTTGGTATACTTTGTGTAGTATTGATAAAAAA
AGGTTTAAAATGTTTGTTTTTGGTTCTGAATTTAAGATAC
TTGTTCTGATTTCTTTTGAAAATGGTCAACAGTGGTTGAA
TACTAATTTATGAATTACCTTCATGTCCTGTCTACAAAAA
AAAAAAAAAAA

pcf11 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pcf11-201 4971
ncRNA pcf11-002 (1)    Ensembl 747
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pcf11-201 Contained in:
[BAC] CH73-115D3 (1)

Genome Resources: Vega_Trans:OTTDART00000049485 (1),  Ensembl_Trans:ENSDART00000065562 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC085652 (1) 4982 nt
CITATIONS (2)