Transcript

pcf11-002

ID
ZDB-TSCRIPT-110325-1437
Name
pcf11-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049486 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049486|OTTDARG00000034858|ZDB-GENE-041114-175 pcf11|no_translation pcf11-002 LG_ CU928848.11 Danio rerio protein_coding KNOWN, 747 bp
ACTCATTTGGTGGTCCAGCCCAGCAGTTTTCCATGCAGCA
AAATGTCTCGCAAACCTCCAACTTCAGTGTGCCAGTTCCT
ACATCATCAGATTTTCAGGGTTCATTTAGACCTCCATTCC
CTGGTCCGGGTGTCGGAGGTGTTCCTCAGCCTGTAAGTAC
TGCCTCACTTATAAAAGTTGCAGAGTGTTTTGTATTGTTG
TTTTCTAAAACAGACATTTAAAATTATATTTCAGATGATG
GGTGCTCAAAACTTCATGCCCCAAAATCCAATGCCTTTTC
AGCCAGGTAATAAATATCCTCTAAATCTGTTATCTGGTGA
TAACCTGAAAATCAATTATACACTACTGTTTGCTTCTTTG
CTTTTGATTGTGAAATCTACTTTAGACCCTTAATGTATTA
AGTGAATTGTTTGTTGTTTCAGTCTCCCAATTTCCACAGC
CTGAGCCAGAGCCATTGAGACAAATAGATGTGAATGATCT
GATGTCTAAGCTTATATCCACTGGAATTATTAAACCTGCA
CCTACAGACTCAACAGCTGACTCCCCATCAGCTAGTCAGA
CTATATCTGTGCCTGAAGAAGAGGAGGAGGAGGAGGAGCA
AGAGCAAGAAGAAGATGACAGTGTCCCAGATTTGACTGGC
TTTATTTTGGATGACATGAAACAGAGACACGAAAGCATTA
TCACTAAACTCTATACTGGAATCCAGTGCTATTCCTGTGG
CATGCGTTTTACTGCATCTCAGACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations