Transcript

alpi.1-203

ID
ZDB-TSCRIPT-110325-467
Name
alpi.1-203
Previous Names
  • alpi-002
  • alpi.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049282 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049282|OTTDARG00000011512|ZDB-GENE-050327-78 alpi.1|OTTDARP00000038674 alpi-002 LG_ BX927181.16 Danio rerio protein_coding KNOWN, 808 bp
GTTTTCTCAGTGCTGCACCGCGCCAAAGCACAAGGAAAGT
CTGTTGGCATCGTGACCACCACCAGAGTCCAGCACGCGTC
GCCGGCTGCTGCGTATGCGCATTCAGTCAGCCGTAAATGG
TACAGCGATGCAGATGTGCCCTCCGAAGCCCGCCGGCAGG
GCTGCAAAGACATCGCCACACAGCTGGTGACCAACACTGA
CATTGATGTCATTCTTGGCGGTGGCCGGATGTACATGACA
CCCAAGGGAACCCCTGACCCAGAATACTCCTCATCATCTC
ACAAAGGAGATCGAAAAGACAAAAAAAATCTTATTAACGT
TTGGCTCAATGCCCGCAAGGGAAGAAACGCCCAGTACGTT
TGGAACAAAGAGCAGTTCAATGCAGTGGATGTTCAAACAA
CAGACTGCCTGATGGGCCTGTTTGAGCCCAAAGATATGAG
ATTTGAGGTGTTCAGGAATCGTACACGTGATCCTTCCATC
GTGGACATGACTGAGAAAGCCATTCAAATCCTCAGCAAGA
ACCCTAAAGGCTTTTTTCTCTTTGTGGAAGATGAGTGTTT
ATCATTTCCAGTGGTTTTACTGCGTAAACTATATATCCGA
CTAACAGCAGAACATGTTTGTGTTCTACGAGGCAGAATAG
ACCACGGACACCACGACGGGGTGGCCAAACTTGCTCTGAC
AGAGACCATCATGTTCGACCGGGCGATTCAGAGAGCGTCC
GAGCTGACCAGTGAATCAGACACGCTCACTGTCGTCACCG
CAGATCATTCCCATGTCTTCACCTTTGGTGGAAAAACTCC
TCGGGGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations