Transcript

alpi.1-204

ID
ZDB-TSCRIPT-090929-2510
Name
alpi.1-204
Previous Names
  • alpi-001
  • alpi.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000013420 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013420|OTTDARG00000011512|ZDB-GENE-050327-78 alpi.1|OTTDARP00000011457 alpi-001 LG_ BX927181.16 Danio rerio protein_coding KNOWN, 1871 bp
GGAGACACTCCTTCCAGCCGTCGAGGTGTGTGCTTCTCTT
TCTCAGAGGCTCGGGATGTGTTTGGTTTACGGTCGGGCCC
CCGGAGCGCTTCTTCTCCTCCTGTTGGCCCTCGTCCTGAA
CACCAGCTGCAGTCTGGACTCCGCGGCTGAATGGGAGAAG
GATCCCGCATACTGGAATGATCAGGCCAGACGGACGCTGC
AGACGGCCCTCACACTGCCTCTCAGAGTCAACCGAGCCAA
AAACATCATCCTCTTCGTTGGTGATGGAATGGGAGTGTCC
ACGGTTTCAGCCGCTCGTATCCTGCGGGGTCAGATGGAAG
GACAGTCCGGGGAGGAGACAATTCTGGCCATGGACACGTT
TCCATATCTCGCCCTGTCAAAGACATATTGTGTGGACAAG
CAGGTCGCGGACAGCGCTAGCACAGCTACAGCGTATCACT
GCGGAGTGAAGGCTAATGCCAAGACGGTGGGCTTGAGTGC
CAAAGCAGTGGCCTACGAGTGCAACACAACATTTGGCAAT
GAGGTTTTCTCAGTGCTGCACCGCGCCAAAGCACAAGGAA
AGTCTGTTGGCATCGTGACCACCACCAGAGTCCAGCACGC
GTCGCCGGCTGCTGCGTATGCGCATTCAGTCAGCCGTAAA
TGGTACAGCGATGCAGATGTGCCCTCCGAAGCCCGCCGGC
AGGGCTGCAAAGACATCGCCACACAGCTGGTGACCAACAC
TGACATTGATGTCATTCTTGGCGGTGGCCGGATGTACATG
ACACCCAAGGGAACCCCTGACCCAGAATACTCCTCATCAT
CTCACAAAGGAGATCGAAAAGACAAAAAAAATCTTATTAA
CGTTTGGCTCAATGCCCGCAAGGGAAGAAACGCCCAGTAC
GTTTGGAACAAAGAGCAGTTCAATGCAGTGGATGTTCAAA
CAACAGACTGCCTGATGGGCCTGTTTGAGCCCAAAGATAT
GAGATTTGAGGTGTTCAGGAATCGTACACGTGATCCTTCC
ATCGTGGACATGACTGAGAAAGCCATTCAAATCCTCAGCA
AGAACCCTAAAGGCTTTTTTCTCTTTGTGGAAGATGGCAG
AATAGACCACGGACACCACGACGGGGTGGCCAAACTTGCT
CTGACAGAGACCATCATGTTCGACCGGGCGATTCAGAGAG
CGTCCGAGCTGACCAGTGAATCAGACACGCTCACTGTCGT
CACCGCAGATCATTCCCATGTCTTCACCTTTGGTGGAAAA
ACTCCTCGGGGGAACCCAATTTTTGGTCTGGCACCTAAAC
AGGCTGAAGATGATCTTCCATACACTAGTATCTTGTATGC
GAACGGGCCAGGATACGATCATGTGAACGGAACAAGAGGA
AATGTTTCCGTTTTGGATTATTATGATGAAGAGTACAAGC
AACAAGCTGCGGTTCCCTTAGAATCCGAGACACACGGAGG
GGAAGATGTGGCTATCTATGCCAAAGGCCCAATGGCACAC
CTCTTTCATGGAGTCAAAGAGCAGAACTATGTGGCCCATG
CCATGGCTTACGCAGCATGCCTTGAGCCGTACACCAACTG
CCCGCTGGATCTGTACAGCTCTGCAGGCTGGAAAACCCCT
CTTTCATTGACTCTGATCTCTCTAACCGGCGTGTTTTGGC
TTGTTTTGAGATGACAGACTCCACTTTATGTGGGCACTCC
GAAGATGCTGAACAGCCCGTGTAGCTCATACTGAAGTTTT
TGCAGTGCACTGCTGCGTGTACATAAATGTAAAGTTGTTG
TTTTTTCACCACATCCAGATATGTTTGTATATATTGCGCA
GCTGACGAATCTTTTGCACTGTGATCACAAATTGCTCAAA
CACGTGAGACCAATAAACTTCTACAAGGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations