Transcript

alpi.1-003

ID
ZDB-TSCRIPT-110325-1375
Name
alpi.1-003
Previous Names
  • alpi-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000049283 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049283|OTTDARG00000011512|ZDB-GENE-050327-78 alpi.1|no_translation alpi-003 LG_ BX927181.16 Danio rerio protein_coding KNOWN, 785 bp
TGCATCTTAAGGAAAGTCTGTTGGCATCGTGACCACCACC
AGAGTCCAGCACGCGTCGCCGGCTGCTGCGTATGCGCATT
CAGTCAGCCGTAAATGGTACAGCGATGCAGATGTGCCCTC
CGAAGCCCGCCGGCAGGGCTGCAAAGACATCGCCACACAG
CTGGTGACCAACACTGACATTGATGTCATTCTTGGCGGTG
GCCGGATGTACATGACACCCAAGGGAACCCCTGACCCAGA
ATACTCCTCATCATCTCACAAAGGAGATCGAAAAGACAAA
AAAAATCTTATTAACGTTTGGCTCAATGCCCGCAAGGGAA
GAAACGCCCAGTACGTTTGGAACAAAGAGCAGTTCAATGC
AGTGGATGTTCAAACAACAGACTGCCTGATGGGCCTGTTT
GAGCCCAAAGATATGAGATTTGAGGTGTTCAGGAATCGTA
CACGTGATCCTTCCATCGTGGACATGACTGAGAAAGCCAT
TCAAATCCTCAGCAAGAACCCTAAAGGCTTTTTTCTCTTT
GTGGAAGATGAGTGTTTATCATTTCCAGTGGTTTTACTGC
GTAAACTATATATCCGACTAACAGCAGAACATGTTTGTGT
TCTACGAGGCAGAATAGACCACGGACACCACGACGGGGTG
GCCAAACTTGCTCTGACAGAGACCATCATGTTCGACCGGG
CGATTCAGAGAGCGTCCGAGCTGACCAGTGAATCAGACAC
GCTCACTGTCGTCACCGCAGATCATTCCCATGTCTTCACC
TTTGGTGGAAAAACTCCTCGGGGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations