ZFIN ID: ZDB-TSCRIPT-110325-427
Transcript Name: ptgs2a-201
Previous Name: ptgs2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049158 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049158|OTTDARG00000034690|ZDB-GENE-020530-2 ptgs2a|OTTDARP00000038578 ptgs2a-001 LG_ CU570979.21 Danio rerio protein_coding KNOWN, 2135 bp
AATACAACGGGCTCGACCAGAGTAACGCATCTCTGCTTCA
ACAGCCTCTAGATAATAACACTTCTGGAATGAATAAACTG
GTTTGCTTGGTCCTACTTTCAAGCATTTGGATCTTTCCTG
GTGAAGGATACGACCCTTGCTGTGCACAGCCTTGCCAAAA
CCAGGGCGTGTGTTTATCCAAGGGAGCTGATGCTTATGAA
TGTGACTGCACCAGGACAGGATATTATGGTGAAAACTGCA
CTACCCCTGAGCTTCTCACACGCATCAAATCAGCTCTGAA
ACCAAGACCAAATGTAGTGCATCATATTTTAACACATTAT
AAATCAATCTGGGATATCATCAACAGCATCTCTTACCTGA
GGGATGGCATAATGCGCTATATCCTGTTGTCAAGGTCCCA
TTTGGTTGAAAGTCCACCGACGTACAATGCTGATTATGGC
TACAAAAGCTGGGAAGCGTACTCTAATTTGTCCTATTACA
CCCGCACCCTTGCCCCGTTGCCCCAAAACTGCCCAACGCC
TGATCTCCCAAATGCCAAGCAGGTGGTGGAGCAGGTGCTG
TTGAGGAAGCAGTTCATCCCTGATCCACAGAGGAGCAGTC
TCATGTTTGCTTTCTTCGCCCAGCATTTCTCTCACCAGTT
CTTCAAGTCGGACTTTAAAAAGGGACCAGCCTTCACCAAA
GCCCTGGGTCATGGAGTGGATCTGGGGCATATTTATGGAG
AGACGCTGGAGGTTCAACACAAACTTCGTCTGTTTAAAGA
TGGAAAGCTTAAATACCAGGTTGTGGATGGTGAGGTGTAC
CCTCCGCTTGTGAAGGACGTCCAGGTGGAGATGCACTACC
CTCCTCATATCCCGGAAGAGCAGAAATTTGCTGTGGGCCA
TGAGGCCTTTGGTCTGGTTCCAGGTTTGATAATGTATGCT
ACCATTTGGCTCCGTGAGCACAACCGTGTCTGTGACATCA
TGAAGCAGGAACATCCTGACTGGGATGATGAGAGAATCTT
CCAAACCACTCGTCTCATCCTGATTGGTGAGACCATCAAA
ATTGTGATCGAGGACTATGTTCAGCACTTGAGTGGATACA
ACTTCAAGCTCAAGTTTGACCCAGAGCTCATCTTCAGTGA
GCGTTTCCAGTACCAGAACCGTATTGCGGCCGAATTCAAT
ACCCTGTATCACTGGCATCCACTGTTGCCGGACAACTTTC
AGATCCAGGATCAGATCTACGGCTATCACCAGTTTGTGTT
TAACAACTCTATCGTCACCACACATGGCATTCGCAACATG
GTGGACTCCTTCACCAAACAGACTGCTGGACGGGTGTCTG
GTGGACGTAACCTGCCACCTGCAGTTCAAGGAGTCGCTGT
TAAAGTTCTGGAACAAACCAGACAGATGCGCTATCAATCT
TTCAATGCATACAGAAGACGCTTCAACATGAAGCCCTACT
CATCCTTTGAGGAGATGACAGGAGACAAAGATCTGGCTGC
CCAGCTGAAGGAGCTGTACGGTCACGTAGACAAGGTTGAG
CTGTATCCTGGCCTTCTTGTGGAGAAATCCAGACCCAACT
CTGTGTTTGGGGAGACTATGGTGGAAATGGGAGCTCCCTA
CTCTCTCAAAGGCCTCATGGGAAATGCTATTTGTTCTCCT
GAATACTGGAAGCCCAGCACATTTGGTGGGAAAGTGGGAT
TTGACATCGTTAACTCGGCTTCACTGAAGAAATTGGTGTG
TTTGAACGTCAGTGGGCCCTGTCCGATGGTGTCCTTTCAG
GTGCCAGATGTGAAATTTCAGAGTTCAGAAAACGTGAATT
CAAGTTCAGTGCACTCCACAGTAAATAATATAAATCCAAC
TGTTGTTTTGAACGAGCGGAGTTCAGAGCTGTAAAAGGTC
TCAAAATCTTCAAAATCCCAGATACTTGATATGGTTTTGT
AATTTATTTATTTTTTATATATATTTATTTGAATAATTTA
TTGCAGTAGTGTATTTATTGATTGTTTTTTTTTTTTGTAT
TGTGATCGATGTGCAACTTTGTTTCATAAATTCATGTGAG
GTATTCAACTAATTGGACAAACACATTTCAAATGCCAATC
AACTGTTGCAAATGTTTATTTCATAAATAAAAACAAATGA
TATTTTGCAAAAATA

ptgs2a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ptgs2a-002 (1) 673
mRNA ptgs2a-201 2135
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptgs2a-201 Contained in:
OTHER ptgs2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049158 (1)
  • Ensembl_Trans:ENSDART00000006870 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY028585 (1) 2150bp
    GenBank:BC056736 (1) 2147bp
    GenBank:BC063232 (1) 2126bp
    CITATIONS (2)