ZFIN ID: ZDB-TSCRIPT-110325-1335
Transcript Name: ptgs2a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049159 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049159|OTTDARG00000034690|ZDB-GENE-020530-2 ptgs2a|no_translation ptgs2a-002 LG_ CU570979.21 Danio rerio protein_coding KNOWN, 673 bp
GATACCCAGCTGAGATGCAAGGCACCCAACCCTCAATTGC
TCCTTGGGCACTCAAAGCAAATAGCTGCCCATTGCTCATA
GTGTGCGTTCACAGGATGTGTTTGTGTGTGTGTTCTCTCA
CTCTTTACTCATAATGTGTGTGTGCACTTGTATTAGTCAA
TTTTAACTATGGGTAATGCCAAACATGACAATACTTACTT
CACTTCATTAAACATCCATGTTTTTTATTTTCTCCCAGGT
GAGACCATCAAAATTGTGATCGAGGACTATGTTCAGCACT
TGAGTGGATACAACTTCAAGCTCAAGTTTGACCCAGAGCT
CATCTTCAGTGAGCGTTTCCAGTACCAGAACCGTATTGCG
GCCGAATTCAATACCCTGTATCACTGGCATCCACTGTTGC
CGGACAACTTTCAGATCCAGGATCAGATCTACGGCTATCA
CCAGTTTGTGTTTAACAACTCTATCGTCACCACACATGGC
ATTCGCAACATGGTGGACTCCTTCACCAAACAGACTGCTG
GACGGGTGTCTGGTGGACGTAACCTGCCACCTGCAGTTCA
AGGAGTCGCTGTTAAAGTTCTGGAACAAACCAGACAGATG
CGCTATCAATCTTTCAATGCATACAGAAGACGCTTCAACA
TGAAGCCCTACTCATCCTTTGAGGAGATGACAG

ptgs2a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptgs2a-201 (1)    Ensembl 2135
ncRNA ptgs2a-002 673
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptgs2a-002 Contained in:
[BAC] CH73-147D18 (1)

Genome Resources: Vega_Trans:OTTDART00000049159 (1),  Ensembl_Trans:ENSDART00000150051 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN506307 (1) 835 nt
CITATIONS (2)