header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2379
Transcript Name: popdc2-202
Previous Name: popdc2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049595 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049595|OTTDARG00000020456|ZDB-GENE-060518-2 popdc2|OTTDARP00000038907 popdc2-002 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 2476 bp
AGAAGCACAGACACTGGAGGGCTGATATTGTCAAATTTAA
AAGGAAGAGTGGGTGTCGAAGGAAACTAAATTATGAAGCT
TCTTTTATTCCAGCTGATTTTGGCCGTAGGAGCGACATTG
ACTTTAAGCAGCTGAAGGGAACAAGCTTTTTATATTCGAC
ATTAGTTTGGCATTTTGTTTACAATCTTTTAAAAACTTGA
ATTATTTTTCCAGAATTTAATGACAGGCTTCTTATAATTC
AGCGTTCCATTGAATTGGAGACAGCAGAGGCTCAAACATG
AATAGCGGCGACTCTTCATTGATTGACGCTGTAATTTACA
ATCACACACTCTGCGATGGATGGACCAACAGCACTGAAGG
TGCCATATACCATCTGGGCAACACCATTCTTTTTCTGGGC
TATATGGGCGGTAGTGGGGCGTATGGGGCTCTGTACATCT
TCAGTTTTCTGGCTCCAGCTTTCCTCTGTCTGGCTCTCTG
GGGCTGGCTGACGATGTGCGGCCTGGATGTCTTCATCTGG
AACCTGCTGCTGATGCTGCAGTGTTTGGCCCAGGTGTGTC
ATCTGATTTTTCGGCTGATGCGGGACGGTTTAGCTAACGA
GGAGTTTTCTGCACTTTACACAGCGGTCTATCTGCCGCTG
GATGTACCTGTGCAGGTGTTTAAGGAGATCACGGGGGCCG
GAGAAAATAAAGTGCTTTCTCTAGCGGCCGAAGAAACGTA
TGCCGTAGAAGGGAAGACGCCTATTGATCAGCTGTCTTTC
CTACTTTCTGGCAGGATTAGAGTGTCTTTGGAGGGCCAGT
TTCTCCATTACATCTTCCCTCACCAGTTTCTTGACTCTCC
AGAATGGGAGTCTTTAAGACCGGCAGAGGAGGGGAACTTT
CAGGTGACACTAACCGCGGAGACGGACTGCCGCTACATCT
CTTGGCGCAGACGTCGGCTTTACCTTCTGCTGTCTAAAGA
TCGTTACATTGCCCGACTTTTCTCAGTCATGCTCGGAAGT
GACATCGCTGACAAACTGTACTCACTCAATGACAAGCTAT
TTGCAAAGAGCGGTGTGCGCCTTGACATTCGTCTGCCCAG
TCTATACCATGTCCTTGCCCCTTCGCCACCAGGCAGTGAG
GGTGGCAGCGCCAGTTCACCACCCAGGGGGAGCCTAGGAG
ACCCTACAGTCATAAAAGTTGATCCGGCACCATCTAATCC
AGGCTCAGGCACAAGAAATCCCCAGCCGGACCAGGGAAAG
AATCCTGTTCCCAAAAATCCACACCAGCATTGGTCCTCGG
ACACAGAGATGCCCTCCGAGGACGATCCTCCAGGACGTTT
TCCACCTCGATACCAAAGAGGACGTGCCCCACTGGCCCCT
AATGACACCCCAAAGCTGTAGAGACGACGAGTCAAGATGA
ATCACTTCTCCCATCAAAAACTGTTTGTTCTCATACGACC
ACACTCACACAGAACAGTTTAAGGATGTGCAAATGTACTG
CTTTCAGGACAAAACCTCCCAAACCACTGTTTTTTCCGAT
AGATACTGTGTTATATATGATTCCACATTGCTGTGATTGA
TCAACATGGCTGATTTATGTTTATTTGCAATAGTGTGTCC
TTTGTAGGGAAGTCTGTTTGGAATAACTGAGACAAAGTTT
AAATACTACAAATTAAAAAATTAACACTTCAGCAGTCGAA
AGATATTAAATTGATAGAGATTTATTACATAAGTGTGAGT
TTAATCATATTAGAATGCTAGTAAATGTTTCAGAATCTTG
TTATTGAGACTGACCATTTTGTGAAAATGTATTTTCACGG
GGCCAACTGTTAAGTGCTGGGTTAAAATGTGACTTGATAT
TCCTCTTAAGATGCCACCATAAAGCAGTAATTAGCACCGT
ATTAGGTATGCAGTTACAAACACTAATGAGGGTAATAAAA
TGTTGCTTGAATGTTGTTGTACCACTTCAAATGATCAAAC
ATCAGTACTTTCAGTACACATATGAACACACAGAATAGCT
ATGGTATGGTAAATGTCTTTTATAATACACAATATTTCTC
TTGTTGATTGTTATCTAACAAAACTGAACAGAAAATTTGC
ATTAAAGGGACAGTTCACCCAAAAAGGGAATTTACTGCCC
ATCAAGTTGTTCCAGACCTTTATAAGTGTCTTTTCTTGAT
TGAATACACAAGAAGAGATTTTGAAAAATGTTAGAAACTG
GTTGCTGTTGAAGTCACTACCAATGAAAGTCAATTTTAAT
TTCAGGGTTTCAAAATCTCTCTTGCTCTCAGTAAAAGTCA
GAATCTCAAACAGGCCTGAAAAAGTGAGTAAATGGTAACA
GAACTTTTATTTTTGGGTGAACTCTCTCTTTAAATAAAAC
TGATTTTCTCAGGAAGAGCTCACAGATAAAACAAAAGTAT
CAGAAATCATATTTGATATTATATTAGGGCTAAATGTGTC
ATTTTGTGAAAACACAATAAATAAATCTAACACTGA

popdc2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA popdc2-201 (1)    Ensembl 2645
popdc2-202 2476
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
popdc2-202 Contained in:
[BAC] RP71-68N21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049595 (1),  Ensembl_Trans:ENSDART00000150160 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC155228 (1) 2508 bp
GenBank:EG575017 (1) 823 bp
GenBank:EB883982 (1) 537 bp
CITATIONS (2)