Transcript

popdc2-202

ID
ZDB-TSCRIPT-110325-2379
Name
popdc2-202
Previous Names
  • popdc2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049595 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049595|OTTDARG00000020456|ZDB-GENE-060518-2 popdc2|OTTDARP00000038907 popdc2-002 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 2476 bp
AGAAGCACAGACACTGGAGGGCTGATATTGTCAAATTTAA
AAGGAAGAGTGGGTGTCGAAGGAAACTAAATTATGAAGCT
TCTTTTATTCCAGCTGATTTTGGCCGTAGGAGCGACATTG
ACTTTAAGCAGCTGAAGGGAACAAGCTTTTTATATTCGAC
ATTAGTTTGGCATTTTGTTTACAATCTTTTAAAAACTTGA
ATTATTTTTCCAGAATTTAATGACAGGCTTCTTATAATTC
AGCGTTCCATTGAATTGGAGACAGCAGAGGCTCAAACATG
AATAGCGGCGACTCTTCATTGATTGACGCTGTAATTTACA
ATCACACACTCTGCGATGGATGGACCAACAGCACTGAAGG
TGCCATATACCATCTGGGCAACACCATTCTTTTTCTGGGC
TATATGGGCGGTAGTGGGGCGTATGGGGCTCTGTACATCT
TCAGTTTTCTGGCTCCAGCTTTCCTCTGTCTGGCTCTCTG
GGGCTGGCTGACGATGTGCGGCCTGGATGTCTTCATCTGG
AACCTGCTGCTGATGCTGCAGTGTTTGGCCCAGGTGTGTC
ATCTGATTTTTCGGCTGATGCGGGACGGTTTAGCTAACGA
GGAGTTTTCTGCACTTTACACAGCGGTCTATCTGCCGCTG
GATGTACCTGTGCAGGTGTTTAAGGAGATCACGGGGGCCG
GAGAAAATAAAGTGCTTTCTCTAGCGGCCGAAGAAACGTA
TGCCGTAGAAGGGAAGACGCCTATTGATCAGCTGTCTTTC
CTACTTTCTGGCAGGATTAGAGTGTCTTTGGAGGGCCAGT
TTCTCCATTACATCTTCCCTCACCAGTTTCTTGACTCTCC
AGAATGGGAGTCTTTAAGACCGGCAGAGGAGGGGAACTTT
CAGGTGACACTAACCGCGGAGACGGACTGCCGCTACATCT
CTTGGCGCAGACGTCGGCTTTACCTTCTGCTGTCTAAAGA
TCGTTACATTGCCCGACTTTTCTCAGTCATGCTCGGAAGT
GACATCGCTGACAAACTGTACTCACTCAATGACAAGCTAT
TTGCAAAGAGCGGTGTGCGCCTTGACATTCGTCTGCCCAG
TCTATACCATGTCCTTGCCCCTTCGCCACCAGGCAGTGAG
GGTGGCAGCGCCAGTTCACCACCCAGGGGGAGCCTAGGAG
ACCCTACAGTCATAAAAGTTGATCCGGCACCATCTAATCC
AGGCTCAGGCACAAGAAATCCCCAGCCGGACCAGGGAAAG
AATCCTGTTCCCAAAAATCCACACCAGCATTGGTCCTCGG
ACACAGAGATGCCCTCCGAGGACGATCCTCCAGGACGTTT
TCCACCTCGATACCAAAGAGGACGTGCCCCACTGGCCCCT
AATGACACCCCAAAGCTGTAGAGACGACGAGTCAAGATGA
ATCACTTCTCCCATCAAAAACTGTTTGTTCTCATACGACC
ACACTCACACAGAACAGTTTAAGGATGTGCAAATGTACTG
CTTTCAGGACAAAACCTCCCAAACCACTGTTTTTTCCGAT
AGATACTGTGTTATATATGATTCCACATTGCTGTGATTGA
TCAACATGGCTGATTTATGTTTATTTGCAATAGTGTGTCC
TTTGTAGGGAAGTCTGTTTGGAATAACTGAGACAAAGTTT
AAATACTACAAATTAAAAAATTAACACTTCAGCAGTCGAA
AGATATTAAATTGATAGAGATTTATTACATAAGTGTGAGT
TTAATCATATTAGAATGCTAGTAAATGTTTCAGAATCTTG
TTATTGAGACTGACCATTTTGTGAAAATGTATTTTCACGG
GGCCAACTGTTAAGTGCTGGGTTAAAATGTGACTTGATAT
TCCTCTTAAGATGCCACCATAAAGCAGTAATTAGCACCGT
ATTAGGTATGCAGTTACAAACACTAATGAGGGTAATAAAA
TGTTGCTTGAATGTTGTTGTACCACTTCAAATGATCAAAC
ATCAGTACTTTCAGTACACATATGAACACACAGAATAGCT
ATGGTATGGTAAATGTCTTTTATAATACACAATATTTCTC
TTGTTGATTGTTATCTAACAAAACTGAACAGAAAATTTGC
ATTAAAGGGACAGTTCACCCAAAAAGGGAATTTACTGCCC
ATCAAGTTGTTCCAGACCTTTATAAGTGTCTTTTCTTGAT
TGAATACACAAGAAGAGATTTTGAAAAATGTTAGAAACTG
GTTGCTGTTGAAGTCACTACCAATGAAAGTCAATTTTAAT
TTCAGGGTTTCAAAATCTCTCTTGCTCTCAGTAAAAGTCA
GAATCTCAAACAGGCCTGAAAAAGTGAGTAAATGGTAACA
GAACTTTTATTTTTGGGTGAACTCTCTCTTTAAATAAAAC
TGATTTTCTCAGGAAGAGCTCACAGATAAAACAAAAGTAT
CAGAAATCATATTTGATATTATATTAGGGCTAAATGTGTC
ATTTTGTGAAAACACAATAAATAAATCTAACACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations