ZFIN ID: ZDB-TSCRIPT-090929-8316
Transcript Name: popdc2-201
Previous Name: popdc2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025590 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025590|OTTDARG00000020456|ZDB-GENE-060518-2 popdc2|OTTDARP00000021041 popdc2-001 LG_ BX511129.15 Danio rerio protein_coding KNOWN, 2645 bp
AGTCCAGTGTGGGACGGGGAACAGAAGCACAGACACTGGA
GGGCTGATATTGTCAAATTTAAAAGGAAGAGTGGGTGTCG
AAGGAAACTAAATTATGAAGCTTCTTTTATTCCAGCTGAT
TTTGGCCGTAGGAGCGACATTGACTTTAAGCAGCTGAAGG
GAACAAGCTTTTTATATTCGACATTAGTTTGGCATTTTGT
TTACAATCTTTTAAAAACTTGAATTATTTTTCCAGAATTT
AATGACAGGCTTCTTATAATTCAGCGTTCCATTGAATTGG
AGACAGCAGAGGCTCAAACATGAATAGCGGCGACTCTTCA
TTGATTGACGCTGTAATTTACAATCACACACTCTGCGATG
GATGGACCAACAGCACTGAAGGTGCCATATACCATCTGGG
CAACACCATTCTTTTTCTGGGCTATATGGGCGGTAGTGGG
GCGTATGGGGCTCTGTACATCTTCAGTTTTCTGGCTCCAG
CTTTCCTCTGTCTGGCTCTCTGGGGCTGGCTGACGATGTG
CGGCCTGGATGTCTTCATCTGGAACCTGCTGCTGATGCTG
CAGTGTTTGGCCCAGGTGTGTCATCTGATTTTTCGGCTGA
TGCGGGACGGTTTAGCTAACGAGGAGTTTTCTGCACTTTA
CACAGCGGTCTATCTGCCGCTGGATGTACCTGTGCAGGTG
TTTAAGGAGATCACGGGGGCCGGAGAAAATAAAGTGCTTT
CTCTAGCGGCCGAAGAAACGTATGCCGTAGAAGGGAAGAC
GCCTATTGATCAGCTGTCTTTCCTACTTTCTGGCAGGATT
AGAGTGTCTTTGGAGGGCCAGTTTCTCCATTACATCTTCC
CTCACCAGTTTCTTGACTCTCCAGAATGGGAGTCTTTAAG
ACCGGCAGAGGAGGGGAACTTTCAGGTGACACTAACCGCG
GAGACGGACTGCCGCTACATCTCTTGGCGCAGACGTCGGC
TTTACCTTCTGCTGTCTAAAGATCGTTACATTGCCCGACT
TTTCTCAGTCATGCTCGGAAGTGACATCGCTGACAAACTG
TACTCACTCAATGACAAGCTATTTGCAAAGAGCGGTGTGC
GCCTTGACATTCGTCTGCCCAGTCTATACCATGTCCTTGC
CCCTTCGCCACCAGGCAGTGAGGGTGGCAGCGCCAGTTCA
CCACCCAGGGGGAGCCTAGGAGACCCTACAGTCATAAAAG
TTGATCCGGCACCATCTAATCCAGGCTCAGGCACAAGAAA
TCCCCAGCCGGACCAGGGAAAGAATCCTGTTCCCAAAAAT
CCACACCAGCATTGGTCCTCGGACACAGAGATGCCCTCCG
GTGAGGACTCAACCAGCTTGATTCTGGAGGACTTTGCAGA
TATGACAGGCTCTCTAATGGACTATGGGCATGAGAGGGAA
TATTTGAAGTAAAGATATGGGTGTTAAAGCTAACACACAC
TTGGACACTTCTTAAATCACAATAGGACGATCCTCCAGGA
CGTTTTCCACCTCGATACCAAAGAGGACGTGCCCCACTGG
CCCCTAATGACACCCCAAAGCTGTAGAGACGACGAGTCAA
GATGAATCACTTCTCCCATCAAAAACTGTTTGTTCTCATA
CGACCACACTCACACAGAACAGTTTAAGGATGTGCAAATG
TACTGCTTTCAGGACAAAACCTCCCAAACCACTGTTTTTT
CCGATAGATACTGTGTTATATATGATTCCACATTGCTGTG
ATTGATCAACATGGCTGATTTATGTTTATTTGCAATAGTG
TGTCCTTTGTAGGGAAGTCTGTTTGGAATAACTGAGACAA
AGTTTAAATACTACAAATTAAAAAATTAACACTTCAGCAG
TCGAAAGATATTAAATTGATAGAGATTTATTACATAAGTG
TGAGTTTAATCATATTAGAATGCTAGTAAATGTTTCAGAA
TCTTGTTATTGAGACTGACCATTTTGTGAAAATGTATTTT
CACGGGGCCAACTGTTAAGTGCTGGGTTAAAATGTGACTT
GATATTCCTCTTAAGATGCCACCATAAAGCAGTAATTAGC
ACCGTATTAGGTATGCAGTTACAAACACTAATGAGGGTAA
TAAAATGTTGCTTGAATGTTGTTGTACCACTTCAAATGAT
CAAACATCAGTACTTTCAGTACACATATGAACACACAGAA
TAGCTATGGTATGGTAAATGTCTTTTATAATACACAATAT
TTCTCTTGTTGATTGTTATCTAACAAAACTGAACAGAAAA
TTTGCATTAAAGGGACAGTTCACCCAAAAAGGGAATTTAC
TGCCCATCAAGTTGTTCCAGACCTTTATAAGTGTCTTTTC
TTGATTGAATACACAAGAAGAGATTTTGAAAAATGTTAGA
AACTGGTTGCTGTTGAAGTCACTACCAATGAAAGTCAATT
TTAATTTCAGGGTTTCAAAATCTCTCTTGCTCTCAGTAAA
AGTCAGAATCTCAAACAGGCCTGAAAAAGTGAGTAAATGG
TAACAGAACTTTTATTTTTGGGTGAACTCTCTCTTTAAAT
AAAACTGATTTTCTCAGGAAGAGCTCACAGATAAAACAAA
AGTATCAGAAATCATATTTGATATTATATTAGGGCTAAAT
GTGTCATTTTGTGAAAACACAATAAATAAATCTAACACTG
AATCA

popdc2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA popdc2-201 2645
popdc2-202 (1)    Ensembl 2476
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
popdc2-201 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000025590 (1),  Ensembl_Trans:ENSDART00000102147 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY293119 (1) 2661 bp
GenBank:EE684650 (1) 950 bp
GenBank:EE326370 (1) 867 bp
GenBank:EB884613 (1) 518 bp
GenBank:CK712469 (1) 190 bp
CITATIONS (2)