Transcript

gpm6ab-206

ID
ZDB-TSCRIPT-110325-2061
Name
gpm6ab-206
Previous Names
  • gpm6ab-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048405 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048405|OTTDARG00000019580|ZDB-GENE-030710-8 gpm6ab|OTTDARP00000037975 gpm6ab-006 LG_ BX649481.10 Danio rerio protein_coding KNOWN, 2901 bp
GTCAAACTCTTGAACTGTGGACTTTTTCAGCGTTGTCGAG
CTCTAGTCTCAAACATGGGTTGCTCTGAATGCTGCCTCAA
ATGTCTGAGTGGGATCCCGTATGCCTCTCTGATCGCCACT
ATCCTGCTGTACGCCGGTGTTGCTCTCTTCTGTGGCTGTG
GACATGAGGCTCTTTCTGGCACCGTCACCATCCTGCAGAC
CTACTTTGATGTCGTCCGGTCGCCTGTTGATGCCCTGGAT
GTCTTTACCATGATTGACATCTTCAAGTATGTGATCTATG
GAGTGGCAGCAGCTTTTTTTGTCTATGGTATTTTGCTGAT
GGTGGAGGGATTTTTCACCACTGGTGCCATCCGGGATCTC
TATGGAGACTTCAAGATCACCACCTGTGGGCGCTGTGTTA
GTGCCTGGTTCATCATGCTTACTTATATCTTCATGTTGGC
CTGGCTGGGAGTCACAGCCTTCACCTCTCTGCCGGTCTTC
ATGTACTTCAACATCTGGAACACTTGTCAGAACATGACTC
TGCTGGAGGGTTCTCTCTCTTCAGCGAACAGCGCCAACCT
TTGCTTTGACCTGCGTCAGTACGGAATCGTGTCCATCGGT
GAAGAGAAAAGACTGTGTGCCGATAATGAAAACTTCAAGA
AGATGTGTGAATCTAATGAGCTGGATCTGACGTTCCACTT
GTTTGTCTGCGCTCTTGCGGGGGCTGGAGCGGCGGTTATC
GCCATGGTGCACTACCTGATGGTGCTGTCGGCTAACTGGG
CTTACGTGAAGGACGCCTGCCGGATGCAGAAATACGAGGA
CATCAAGTCCAAGGAGGAGCAGGAGCTTCATGATATCCAC
TCTACTCGCTCTAAAGAGCGCCTGAACGCATACACATAAA
GCACGCGCTTGCGCGCACACGTATAAATATGTATACACAC
ACATACATACATACACAAGCATGCCCTTCCCCTTCCCTGA
AAACAAATATATAAACAACACTTAAATAAAAAGCTAATTT
CCATGGTTTCCAGGGGTAAGGGATAGGATGGCACGGGGAG
GTAAATAACTGTAACACTTGCTATGTACGGGTGTGACCCA
GAATGTTGGTCTAGGGACGTGGTTTGCGTCTCCATGTCAA
CGTCTCTGACTACCCCTTTTAATTTCTCTGTCCGATTTCA
TTTCTCCTACACCTCCCCTTTCTGTTGCTCCTGATAAACA
CACCGAGTTGAGTGGCTTTTTTTGTACCACGTAGTTGTAG
GTCTCATCGGGTCTTACTAGGGGGTCGGGGTTTAGCCAAA
GGGATTACAGCAGCACACTTTTCACATTTTTGTATTACAC
GCTGATGATTTACAGTACATTCTGCAAGCTCACCCTGACA
ATAGTCAAGATTTAGATTTTCCTTTAGATTTTCTATGAAC
CAAAATGTGACCAAACTTGTAACTTATGATTTACAGGTTC
AAAAATCGCTCAAGCTGCCACAACTTAACAGCAGCAACAG
CACAAACAATGTACAGATTCTTTGTTTTTGGACAAATTCA
GCTTTAGAGTGCCAGGGATTAAAAAAAAAAGTACCTTAAA
GTGACTTTTACTGCTATACTGTAGCTTGGCCTAACTGTAT
ACGCTAGCTGTGCGCAGTATTAATGGAAAGTGTGACACTG
GTGCTTAGTAAGCATTTGACGGAGACTGATTGGGAATGAA
GGAACGTTGAAAGAATGTTTTAAATCAGCTAGGTTGGTCA
AGCAGGATTTGCCTTGGGAGACTCTATGAATATATGATTT
CCTCTCATTCATCGCAAGCCATACTCTCACATGCAAATAA
CATTTTCAGGTGTTTTATTGCTTAGTTTTAGCTTTAACTT
TTTAAATGCAAGAAATCAAACAGTTCTTTAGTCATTCCTC
TGATCTGTACTGTATATATCTCTCTATCTCTCTTTAAATG
TATACACATTTCATGTCAATTTCACATCTCGGCAGTCAGT
GTTACAGTAGGTGATATTCTTGAGATCGTCGTTCATATCA
GAGAAGTATAAATCTAAATGGAAAAGTTGATCGCAACGAC
TTTGCCAAACACTGTGGAAGGTTGAATTAACGTGGTGTTT
ATGTAACATTCAAACGTGTTTTGAATGAGGACTTGATGGA
TGTGGTTGTACAAGCATGTATTACTCTAAGTCAGTGTTTT
GGCTCGGTCTTGCAGACTTGAGTTGCCCTACTTTTGCAGT
AAAGTACTTTTGTCAGTGTCTCAAAAAAGAAACAAAAAAT
CTACAAAAACAAGCTCGTTTTGTGCACTTATGGACCATCG
TGAGTTTTTTGGTGTAAGTGCATTTGGAATCAGCGCTGAG
TCTCTTAATAGTCATGCAGCTTTTTTTAAAAACCACAAAA
GAAACTTGTATTAGGTCAAAACCGTAAATCTAGTTGTTAT
TTGTGGCATGGGTATGCATCTAATGGTAATAGTTTTAACT
AACTGAAAAAGGCAAAAAAAAAATGAATCCTTTATTTTGA
TTTTTACACTTCTGACTGTCTTGCTGGGGTCAACTATATA
AATTTTTTTTCTAAATGTGCAGTATTTACAGTTGCTACGC
TAACGATATTAAGCTAAATATCTTATTAGGTTGTAGTGTT
TGAGTTCTGTCCTTTCTAGTTTGTGATGATTTTTCCGAAC
CATGTCTTAATCCTATACTTGTTATGATGTTGCGTATCCA
GTATTACCCTGACATTGCTTTTAGCTTTATCCACATACTG
TACTAGTTCTTTTCTTTTTCTTTTTTGTACTTTCGCTGAG
AATGCTTTGTAGCAGGCAGTAAAATTAACTGGTTTTGTAC
ATAAATGTGCCAACAGCTTGACAGTGGCTTTTTCTTTTCT
TTTCAATCTGTAGGAACAAACTTGCTTGCGTAAATAAAGA
CACTTGTGTACTTGTTAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations