Transcript

gpm6ab-201

ID
ZDB-TSCRIPT-090929-6980
Name
gpm6ab-201
Previous Names
  • gpm6ab-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024093 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024093|OTTDARG00000019580|ZDB-GENE-030710-8 gpm6ab|OTTDARP00000019939 gpm6ab-001 LG_ BX649481.10 Danio rerio protein_coding KNOWN, 3327 bp
AGATGCTCAAAACACCAGCAGTACGAAGGCTCAAAGTGTC
TAAAATCAACAATTAACCGATGCAACGATCTCAGAGACAA
TTATCAAATATTTTCGCCTGATAGGCCAATTATCATATTT
ATTGCGAAGCGGCGCAAAAAAAGAATTTGAATTCCTACAG
TAGTTCCAAACGCAGCCTGACTTCTTTTGCAATGGACAGC
TTTTGAAAGAGACAGCTGAAGATTGCGTTGAGTGATATCT
GCGGTCGAGAAGAGGAGCAGCGGAGCTCAGCGAGTCCCTT
ACCGAGCGCGCGCGCGCACACACACACACACAAGCACGCC
CGCTCCAGCTCTTCTCCACACACACGCGCTCAATCTCGCC
ACCGCGCGCACAGACGCTCATCCACTTGACCGGTTTATAG
GTATTGTTACATTCCGTCTACTTCTATAACCAGAGCTTTG
AAGCACAATGGAAGAGAACATGGAAGAGGGACAGACGCAG
AAAGGTTGCTCTGAATGCTGCCTCAAATGTCTGAGTGGGA
TCCCGTATGCCTCTCTGATCGCCACTATCCTGCTGTACGC
CGGTGTTGCTCTCTTCTGTGGCTGTGGACATGAGGCTCTT
TCTGGCACCGTCACCATCCTGCAGACCTACTTTGATGTCG
TCCGGTCGCCTGTTGATGCCCTGGATGTCTTTACCATGAT
TGACATCTTCAAGTATGTGATCTATGGAGTGGCAGCAGCT
TTTTTTGTCTATGGTATTTTGCTGATGGTGGAGGGATTTT
TCACCACTGGTGCCATCCGGGATCTCTATGGAGACTTCAA
GATCACCACCTGTGGGCGCTGTGTTAGTGCCTGGTTCATC
ATGCTTACTTATATCTTCATGTTGGCCTGGCTGGGAGTCA
CAGCCTTCACCTCTCTGCCGGTCTTCATGTACTTCAACAT
CTGGAACACTTGTCAGAACATGACTCTGCTGGAGGGTTCT
CTCTCTTCAGCGAACAGCGCCAACCTTTGCTTTGACCTGC
GTCAGTACGGAATCGTGTCCATCGGTGAAGAGAAAAGACT
GTGTGCCGATAATGAAAACTTCAAGAAGATGTGTGAATCT
AATGAGCTGGATCTGACGTTCCACTTGTTTGTCTGCGCTC
TTGCGGGGGCTGGAGCGGCGGTTATCGCCATGGTGCACTA
CCTGATGGTGCTGTCGGCTAACTGGGCTTACGTGAAGGAC
GCCTGCCGGATGCAGAAATACGAGGACATCAAGTCCAAGG
AGGAGCAGGAGCTTCATGATATCCACTCTACTCGCTCTAA
AGAGCGCCTGAACGCATACACATAAAGCACGCGCTTGCGC
GCACACGTATAAATATGTATACACACACATACATACATAC
ACAAGCATGCCCTTCCCCTTCCCTGAAAACAAATATATAA
ACAACACTTAAATAAAAAGCTAATTTCCATGGTTTCCAGG
GGTAAGGGATAGGATGGCACGGGGAGGTAAATAACTGTAA
CACTTGCTATGTACGGGTGTGACCCAGAATGTTGGTCTAG
GGACGTGGTTTGCGTCTCCATGTCAACGTCTCTGACTACC
CCTTTTAATTTCTCTGTCCGATTTCATTTCTCCTACACCT
CCCCTTTCTGTTGCTCCTGATAAACACACCGAGTTGAGTG
GCTTTTTTTGTACCACGTAGTTGTAGGTCTCATCGGGTCT
TACTAGGGGGTCGGGGTTTAGCCAAAGGGATTACAGCAGC
ACACTTTTCACATTTTTGTATTACACGCTGATGATTTACA
GTACATTCTGCAAGCTCACCCTGACAATAGTCAAGATTTA
GATTTTCCTTTAGATTTTCTATGAACCAAAATGTGACCAA
ACTTGTAACTTATGATTTACAGGTTCAAAAATCGCTCAAG
CTGCCACAACTTAACAGCAGCAACAGCACAAACAATGTAC
AGATTCTTTGTTTTTGGACAAATTCAGCTTTAGAGTGCCA
GGGATTAAAAAAAAAAGTACCTTAAAGTGACTTTTACTGC
TATACTGTAGCTTGGCCTAACTGTATACGCTAGCTGTGCG
CAGTATTAATGGAAAGTGTGACACTGGTGCTTAGTAAGCA
TTTGACGGAGACTGATTGGGAATGAAGGAACGTTGAAAGA
ATGTTTTAAATCAGCTAGGTTGGTCAAGCAGGATTTGCCT
TGGGAGACTCTATGAATATATGATTTCCTCTCATTCATCG
CAAGCCATACTCTCACATGCAAATAACATTTTCAGGTGTT
TTATTGCTTAGTTTTAGCTTTAACTTTTTAAATGCAAGAA
ATCAAACAGTTCTTTAGTCATTCCTCTGATCTGTACTGTA
TATATCTCTCTATCTCTCTTTAAATGTATACACATTTCAT
GTCAATTTCACATCTCGGCAGTCAGTGTTACAGTAGGTGA
TATTCTTGAGATCGTCGTTCATATCAGAGAAGTATAAATC
TAAATGGAAAAGTTGATCGCAACGACTTTGCCAAACACTG
TGGAAGGTTGAATTAACGTGGTGTTTATGTAACATTCAAA
CGTGTTTTGAATGAGGACTTGATGGATGTGGTTGTACAAG
CATGTATTACTCTAAGTCAGTGTTTTGGCTCGGTCTTGCA
GACTTGAGTTGCCCTACTTTTGCAGTAAAGTACTTTTGTC
AGTGTCTCAAAAAAGAAACAAAAAATCTACAAAAACAAGC
TCGTTTTGTGCACTTATGGACCATCGTGAGTTTTTTGGTG
TAAGTGCATTTGGAATCAGCGCTGAGTCTCTTAATAGTCA
TGCAGCTTTTTTTAAAAACCACAAAAGAAACTTGTATTAG
GTCAAAACCGTAAATCTAGTTGTTATTTGTGGCATGGGTA
TGCATCTAATGGTAATAGTTTTAACTAACTGAAAAAGGCA
AAAAAAAAATGAATCCTTTATTTTGATTTTTACACTTCTG
ACTGTCTTGCTGGGGTCAACTATATAAATTTTTTTTCTAA
ATGTGCAGTATTTACAGTTGCTACGCTAACGATATTAAGC
TAAATATCTTATTAGGTTGTAGTGTTTGAGTTCTGTCCTT
TCTAGTTTGTGATGATTTTTCCGAACCATGTCTTAATCCT
ATACTTGTTATGATGTTGCGTATCCAGTATTACCCTGACA
TTGCTTTTAGCTTTATCCACATACTGTACTAGTTCTTTTC
TTTTTCTTTTTTGTACTTTCGCTGAGAATGCTTTGTAGCA
GGCAGTAAAATTAACTGGTTTTGTACATAAATGTGCCAAC
AGCTTGACAGTGGCTTTTTCTTTTCTTTTCAATCTGTAGG
AACAAACTTGCTTGCGTAAATAAAGACACTTGTGTACTTG
TTAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations