Transcript

gpm6ab-202

ID
ZDB-TSCRIPT-090929-6981
Name
gpm6ab-202
Previous Names
  • gpm6ab-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024094 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024094|OTTDARG00000019580|ZDB-GENE-030710-8 gpm6ab|OTTDARP00000019940 gpm6ab-002 LG_ BX649481.10 Danio rerio protein_coding KNOWN, 3391 bp
TTCAGCGTTGTCGAGCTCTAGTCTCAAACATGGGTTGCTC
TGAATGCTGCCTCAAATGTCTGAGTGGGATCCCGTATGCC
TCTCTGATCGCCACTATCCTGCTGTACGCCGGTGTTGCTC
TCTTCTGTGGCTGTGGACATGAGGCTCTTTCTGGCACCGT
CACCATCCTGCAGACCTACTTTGATGTCGTCCGGTCGCCT
GTTGATGCCCTGGATGTCTTTACCATGATTGACATCTTCA
AGTATGTGATCTATGGAGTGGCAGCAGCTTTTTTTGTCTA
TGGTATTTTGCTGATGGTGGAGGGATTTTTCACCACTGGT
GCCATCCGGGATCTCTATGGAGACTTCAAGATCACCACCT
GTGGGCGCTGTGTTAGTGCCTGGTTCATCATGCTTACTTA
TATCTTCATGTTGGCCTGGCTGGGAGTCACAGCCTTCACC
TCTCTGCCGGTCTTCATGTACTTCAACATCTGGAACACTT
GTCAGAACATGACTCTGCTGGAGGGTTCTCTCTCTTCAGC
GAACAGCGCCAACCTTTGCTTTGACCTGCGTCAGTACGGA
ATCGTGTCCATCGGTGAAGAGAAAAGACTGTGTGCCGATA
ATGAAAACTTCAAGAAGATGTGTGAATCTAATGAGCTGGA
TCTGACGTTCCACTTGTTTGTCTGCGCTCTTGCGGGGGCT
GGAGCGGCGGTTATCGCCATGGTGGTGGCCGTGTCTGTCC
TCATCAATAACCACGCCAGTCTGACATCTAAGAACGCAGG
GAGGTACTGCACGCGTTTCTGAGGCCAGCTCCGGGGTGTT
TCTGGAGTGTCCCTCCCCACACCCCGACACACTCTCTGTC
CACCAAGGACCCCTCCACCATCGCCCACGACAGCCACTTT
TACAATGACGTCCCTTAATTGGCTTGATTAAAAGACACCC
ATGCCATTCCATTTTGCAATATGGTTTCAATCTCCCCTCC
TCCGATTCCTTCCCACCCTAATAAAGCTGCGTCGCCCCAA
GTTAACTCCGCAGTTACAAACGTTAACATGCAGGAATGAA
CTAACATGGCTTGTTTTATTCAGTTGGAACTGGTTGCCAC
ATTATCTTGACTTGAACTCCAAAACCGGAACACTAAATTC
CCTCTAAGTTGACTCCCGAGTAATCTTTTGACCTCTTCTT
TCGGTATAAAGAGCACTAACACTAACCCACCCCTCTAACC
ACTTGTGTTGCTTTAGGTGCACTACCTGATGGTGCTGTCG
GCTAACTGGGCTTACGTGAAGGACGCCTGCCGGATGCAGA
AATACGAGGACATCAAGTCCAAGGAGGAGCAGGAGCTTCA
TGATATCCACTCTACTCGCTCTAAAGAGCGCCTGAACGCA
TACACATAAAGCACGCGCTTGCGCGCACACGTATAAATAT
GTATACACACACATACATACATACACAAGCATGCCCTTCC
CCTTCCCTGAAAACAAATATATAAACAACACTTAAATAAA
AAGCTAATTTCCATGGTTTCCAGGGGTAAGGGATAGGATG
GCACGGGGAGGTAAATAACTGTAACACTTGCTATGTACGG
GTGTGACCCAGAATGTTGGTCTAGGGACGTGGTTTGCGTC
TCCATGTCAACGTCTCTGACTACCCCTTTTAATTTCTCTG
TCCGATTTCATTTCTCCTACACCTCCCCTTTCTGTTGCTC
CTGATAAACACACCGAGTTGAGTGGCTTTTTTTGTACCAC
GTAGTTGTAGGTCTCATCGGGTCTTACTAGGGGGTCGGGG
TTTAGCCAAAGGGATTACAGCAGCACACTTTTCACATTTT
TGTATTACACGCTGATGATTTACAGTACATTCTGCAAGCT
CACCCTGACAATAGTCAAGATTTAGATTTTCCTTTAGATT
TTCTATGAACCAAAATGTGACCAAACTTGTAACTTATGAT
TTACAGGTTCAAAAATCGCTCAAGCTGCCACAACTTAACA
GCAGCAACAGCACAAACAATGTACAGATTCTTTGTTTTTG
GACAAATTCAGCTTTAGAGTGCCAGGGATTAAAAAAAAAA
GTACCTTAAAGTGACTTTTACTGCTATACTGTAGCTTGGC
CTAACTGTATACGCTAGCTGTGCGCAGTATTAATGGAAAG
TGTGACACTGGTGCTTAGTAAGCATTTGACGGAGACTGAT
TGGGAATGAAGGAACGTTGAAAGAATGTTTTAAATCAGCT
AGGTTGGTCAAGCAGGATTTGCCTTGGGAGACTCTATGAA
TATATGATTTCCTCTCATTCATCGCAAGCCATACTCTCAC
ATGCAAATAACATTTTCAGGTGTTTTATTGCTTAGTTTTA
GCTTTAACTTTTTAAATGCAAGAAATCAAACAGTTCTTTA
GTCATTCCTCTGATCTGTACTGTATATATCTCTCTATCTC
TCTTTAAATGTATACACATTTCATGTCAATTTCACATCTC
GGCAGTCAGTGTTACAGTAGGTGATATTCTTGAGATCGTC
GTTCATATCAGAGAAGTATAAATCTAAATGGAAAAGTTGA
TCGCAACGACTTTGCCAAACACTGTGGAAGGTTGAATTAA
CGTGGTGTTTATGTAACATTCAAACGTGTTTTGAATGAGG
ACTTGATGGATGTGGTTGTACAAGCATGTATTACTCTAAG
TCAGTGTTTTGGCTCGGTCTTGCAGACTTGAGTTGCCCTA
CTTTTGCAGTAAAGTACTTTTGTCAGTGTCTCAAAAAAGA
AACAAAAAATCTACAAAAACAAGCTCGTTTTGTGCACTTA
TGGACCATCGTGAGTTTTTTGGTGTAAGTGCATTTGGAAT
CAGCGCTGAGTCTCTTAATAGTCATGCAGCTTTTTTTAAA
AACCACAAAAGAAACTTGTATTAGGTCAAAACCGTAAATC
TAGTTGTTATTTGTGGCATGGGTATGCATCTAATGGTAAT
AGTTTTAACTAACTGAAAAAGGCAAAAAAAAAATGAATCC
TTTATTTTGATTTTTACACTTCTGACTGTCTTGCTGGGGT
CAACTATATAAATTTTTTTTCTAAATGTGCAGTATTTACA
GTTGCTACGCTAACGATATTAAGCTAAATATCTTATTAGG
TTGTAGTGTTTGAGTTCTGTCCTTTCTAGTTTGTGATGAT
TTTTCCGAACCATGTCTTAATCCTATACTTGTTATGATGT
TGCGTATCCAGTATTACCCTGACATTGCTTTTAGCTTTAT
CCACATACTGTACTAGTTCTTTTCTTTTTCTTTTTTGTAC
TTTCGCTGAGAATGCTTTGTAGCAGGCAGTAAAATTAACT
GGTTTTGTACATAAATGTGCCAACAGCTTGACAGTGGCTT
TTTCTTTTCTTTTCAATCTGTAGGAACAAACTTGCTTGCG
TAAATAAAGACACTTGTGTACTTGTTAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations