Transcript

tnnt2a-203

ID
ZDB-TSCRIPT-110325-176
Name
tnnt2a-203
Previous Names
  • tnnt2a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048109 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048109|OTTDARG00000034080|ZDB-GENE-000626-1 tnnt2a|OTTDARP00000037750 tnnt2a-002 LG_ CU928303.2 Danio rerio protein_coding KNOWN, 693 bp
TCTCTGCTGCGTGTCAGATCAGAGCAAACATGTCAGACAA
CGAAGAAGTGGAAGAGTACGAGGAGCAGGAGGAAGAGCAA
GTGGAGGAGGAGGAGGAGGTGCAGGAGGAGGCGCAGAATG
ATGAAGAGGCTCAGCAGGAGGAGAACGCAGGAGGAGATGA
AGAGACCACTCAGGAACACGAGGAGGCTAAGCCCAAATTC
CTAAAACCATTTATGCTGCCAAATCTGGTGCCTCCAAAGA
TTCCAGATGGAGAAAGAGTCGATTTTGATGACATCCACCG
TAAGCGCATGGAGAAGGACCTGAATGAGCTGCAGACGCTG
ATCGAAGCTCACTTTGAAAGCCGTAAGAAGGAGGAAGAGG
AAATCATCAGCCTCAAAGACAGAATTGAGAAGCGTCGTTC
GGAGCGAGCAGAGCAGCAGAGAATCCGCAGCGAACGCGAA
AGGGAGCGACAGAAGCGTTTGGAGGAGGAAAGAGCTCGCA
AGGAGGAAGAGGAAGCCAAAAAGAGAGCAGAAGATGATGC
CAAGAAGAAGAAGACGCTCACCAGTCTGCACTTCGGCGGT
TACATGCAAAAGATAGAGAGACGGAGTGGAAAGAAACAGA
CTGAGAGAGAGAAGAAGAAGAAGATTCTCGGTGATCGACG
CAAACCTCTGGACATTGACAATGCCAATGAATCTGCTCTC
AGAGAGAAAGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations