Community Action Needed: Please respond to the NIH RFI
Transcript

tnnt2a-001

ID
ZDB-TSCRIPT-090929-23284
Name
tnnt2a-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004005 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004005|OTTDARG00000003817|ZDB-GENE-000626-1 tnnt2a|OTTDARP00000003656 tnnt2-001 LG_ AL662878.2 Danio rerio protein_coding KNOWN, 866 bp
GCTGAGCTGGTTTTCCTCTGCATCTCTGCTGCGTGTCAGA
TCAGAGCAAACATGTCAGACAACGAAGAAGTGGAAGAGTA
CGAGGAGCAGGAGGAAGAGCAAGTGGAGGAGGAGGAGGAG
GTGCAGGAGGAGGCGCAGCATGATGAAGAGGCTCAGCAGG
AGGAGAACGCAGGAGGAGATGAAGAGACCACTCAGGAACA
CGATGGAGAAGAGGAGACAGAAGATGGAGGAGAGGAGGCT
AAGCCCAAATTCCTAAAACCATTTATGCTGCCAAATCTGG
TGCCTCCAAAGATTCCAGATGGAGAAAGAGTCGATTTTGA
TGACATCCACCGTAAGCGCATGGAGAAGGACCTGAATGAG
CTGCAGACGCTGATCGAAGCTCACTTTGAAAGCCGTAAGA
AGGAGGAAGAGGAAATCATCAGCCTCAAAGACAGAATTGA
GAAGCGTCGTTCCGAGCGAGCAGAGCAGCAGAGAATCCGC
AGCGAACGCGAAAGGGAGCGACAGAAGCGTTTGGAGGAGG
AAAGAGCTCGCAAGGAGGAAGAGGAAGCCAAAAAGAGAGC
AGAAGATGATGCCAAGAAGAAGAAGACACTCACCAGTCTG
CACTTCGGCGGTTACATGCAAAAGATAGAGAGACGGAGTG
GAAAGAAACAGACTGAGAGAGAGAAGAAGAAGAAGATTCT
CGGTGATCGACGCAAACCTCTGGACATTGACAATGCCAAT
GAATCTGCTCTCAGAGAGAAAGCAAAGGAATTGTGGAGCT
GGATGCGTGAACTAGAAGCAGAGAAGTTTGAGTTACAGTA
TCAGTTCGGCAAACAGAAATATGAGATCAATGTTCTGAGG
AACAGAGTCAGTGACCATCAGAAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations