Transcript

tgif1-202

ID
ZDB-TSCRIPT-110325-1416
Name
tgif1-202
Previous Names
  • tgif1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049421 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049421|OTTDARG00000031808|ZDB-GENE-030131-475 tgif1|OTTDARP00000038769 tgif1-002 LG_ CU459174.13 Danio rerio protein_coding KNOWN, 730 bp
ACACACTGATTCCCAGCTTACTCATTCCCTGAAACACTTA
TTGCTGGTTACAAACACATTGCTCATACATCAGTCTGACT
TTACACTTTTCCTCATTCTGTACACACATATGCACGTGCA
GAATAAACAATACGTTTTAGCTCTGGTCTCTTATGAATGC
AGGTGTTTTGGCGATGTCAGGAAGCGAGACGGAGGATGAG
GACAGTTTGGATGTGCCTCTTGACCTCTCTTCGAATGGAG
GAGTGTCAGGGAAGAGGAAGAGGAGAGGAAACTTGCCCAA
AGAGTCGGTACAAATACTCCGGGACTGGCTCTACCAACAC
AGATACAATGCCTATCCATCAGAGCAGGAAAAAGCCCTGC
TGTCCAAGCAGACCCATCTATCCACACTACAGGTTTGCAA
CTGGTTTATAAATGCGCGGCGACGACTCCTTCCTGAGATG
CTCCGGAAAGATGGCAAGGACCCCAACCAGTTCACCATCT
CGCGGCGGGGCAGCAAGGGTGGCGAAATGCTCAGTGACAA
CTCCCAGTCCCCGAAACACGGTCTGCTCGCCAACGGAGAA
GACCGCAACAGCTACGAGCCTGGCTCACCTCACCCGACCA
GCAACACACCCACTTCCAACGGTTACCCCAAAAAGGCCCT
GTCCCCTAAAACACCTCCCTCGCCCGGACCTGTCTTACCC
AGACCCTCCGTCATCTGCCACACCACTATCACCACAGCCA
CGCAAGGCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations