Transcript

tgif1-201

ID
ZDB-TSCRIPT-091110-472
Name
tgif1-201
Previous Names
  • tgif1-001
  • ch211-248a16.2-001
  • ch211-285f17.1-001
  • ottdart00000044323
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044323 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044323|OTTDARG00000031808|ZDB-GENE-030131-475 tgif1|OTTDARP00000035079 tgif1-001 LG_ CU459174.13 Danio rerio protein_coding KNOWN, 2302 bp
ATGTCCAAACACGTCTCCACAAACACATCCCGCGCGCCAG
ATCTTTCTCTACACACGTTACAGATTCAAATCGGTTTGTC
TAAAAGCCCCTTTTCTGTCTCTTTTTACTCTTATTGTACG
TCTGATGTCAGATTTTTCCTTCTTGCCCTCGGAGGGGGAG
GATCTAACCGCGTTGAGTCACGCAGCTGTCAAAGATAGCT
GTCACCCAGTTTCCACATCAAACACAGTGAATGAGACGCG
CAGCCTGTCCCAGGTACCCGACAATGTGTTGCGTCTCCGA
CAAATGAAAAACGCGCTCCGCGGTGATTCCTCGACAAAAA
AGAGAAATATTTGCGCTCGATACTTCGTAACAATCTGGAA
TAATACAGTTGTGAGTGATTAAAGCGAGGAAGAATCGACC
TCCTTGTTGCCAACGTGAAAAGGGGAATTTTGACGGACAT
GAAGACCAAAAAGGGTGTTTTGGCGATGTCAGGAAGCGAG
ACGGAGGATGAGGACAGTTTGGATGTGCCTCTTGACCTCT
CTTCGAATGGAGGAGTGTCAGGGAAGAGGAAGAGGAGAGG
AAACTTGCCCAAAGAGTCGGTACAAATACTCCGGGACTGG
CTCTACCAACACAGATACAATGCCTATCCATCAGAGCAGG
AAAAAGCCCTGCTGTCCAAGCAGACCCATCTATCCACACT
ACAGGTTTGCAACTGGTTTATAAATGCGCGGCGACGACTC
CTTCCTGAGATGCTCCGGAAAGATGGCAAGGACCCCAACC
AGTTCACCATCTCGCGGCGGGGCAGCAAGGGTGGCGAAAT
GCTCAGTGACAACTCCCAGTCCCCGAAACACGGTCTGCTC
GCCAACGGAGAAGACCGCAACAGCTACGAGCCTGGCTCAC
CTCACCCGACCAGCAACACACCCACTTCCAACGGTTACCC
CAAAAAGGCCCTGTCCCCTAAAACACCTCCCTCGCCCGGA
CCTGTCTTACCCAGACCCTCCGTCATCTGCCACACCACTA
TCACCACAGCCACGCAAGGCATCAACACAACAACGCGCCT
CGGCGTCGAGGGAGCCACAGAGCTGCCACTCACAGATGCG
GCCAGCCTATTCGGGTGTCGAGGGGAGGGTAACGTCAGCC
CTCAGAGCGGCCTGTTCAACACCCCTCCGCCCACCCCACC
CGACCTCACCCAGGACTTCAGCGGTTTCCAGCTGCTGGTT
GACGTAGCGCTGAAGAGGGCTGCCGAAATGGAGCTGCAGG
CCAAAAAGCTCCTCGCCTGAAGAAAAAAAAAACGGATGGA
GGAATTAAAGAGCTTCATCGATGTTTGTTTTTCGCCCCCC
CCCCCAAATGTGAACTCCACTGGGAGTTCATAAAAAACTT
GACTGAGCAACAAAGCAAACTAGCATGGCCTGATCATTTC
TATTTTTGGTAAATCAAATTGATGAGGATTCCTTTATGTA
AAGCATTTCAAGGTGCCTTGGCAGTTCTTTTTTTTGTATT
CCATTTATATGTAAATAAATATGTATCTTCATTTTGTACA
CAGGGGACCAAAATCAAACACAGTAATACGACTTCCTTCT
TTACGAGAAGACGAGCTTTTCTCCCATTCCTCATGAGTCT
TTCTTTCTCGTTTTCAGAGATTCGGCTCTATGATTGTCAA
TTTATGCCTCGTTTTTAGAGAACACGTCTGATATTCTGCC
TCGTTTTCTTTTGCACAATATGGCAGGTCATCTCAGTATC
TTATCAACTCTAGCTTTCTCTCCAACAGACTCTAATCACT
ACTGCACCAGGTCATTCTGTGTCTCATAGATGTTCAGTTC
TTTTGTATTTTCTTTGTTGTTGTAAAGTTTCAGATGCTGT
TAGTACGTTTGTTTTCTTCATTACTCTCGAGGGATATTCA
GATGTAGCAGAACTATAGTCTGAGATTTCCTCTGAATACT
CAGTGTAGAAACGGCCAGTGAATGTGCCCACATACTTCCC
TCCCCACCCCTACACACACATACATACACGCAAACAAATA
CACACCTTGGACAAGTGAGCTGGAAGAATAAAACACTACA
TGAATCGTATTAAGTTTTTTTGTTTTGTTTCTTTTTTTGC
TGTTTATTACGTTGAGACCACTTTCAGAGGATAAAATGAA
AAGAATGGTTTTATGTCACCAAATATGTTGATTTCAAGGT
TTTGGGACCTTAGACCAGTGCATTTACAGTAGCCAATGTG
ACATGATGCCCAATGATGTGACTTCTCCTCCTTACTGTGC
AATGTATGTGGCAAATAGGGGTCACACGGTGTTTAAATAA
AGTTTTGTTTTCTACAAAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations