Transcript

ta-002

ID
ZDB-TSCRIPT-110325-1343
Name
ta-002
Previous Names
  • ntla-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049183 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049183|OTTDARG00000032979|ZDB-GENE-980526-437 ta|no_translation ntla-002 LG_ CU633985.10 Danio rerio protein_coding KNOWN, 851 bp
AACAGTCGGTGGCTGGTTCCTGCCCAGTAACGGCCCCATG
GGCCCCAGCAGCAGCCCTCCTCAGTTCAATGGGGCCCCTG
TTCACTCCTCGGGTTCGTACTGTGAGAGATACTCCAGCTT
GAGGAACCACAGAGCTGCTCCATATCCCAGCCATTACTCC
CACCGCAGCACTACCACCAATAACTACATGGACAACTCTT
CCGGAAGTCTTGCGTCTCATGACAGCTGGTCAGCCCTGCA
GATCCCCAACTCCAGCGGGATGGGAACCCTGGCCCACACC
ACAAACACTACCTCCAACACCAGTCAGTACCCAAGTCTGT
GGTCAGTTGCAGGGACGACTCTCACCCCATCAGGCTCAGC
ATCGGGCTCCATTACAGGTGGCCTGACATCTCAGTTCCTA
CGCGGTTCTTCGATGTCCTACTCGGGTCTGACCTCCTCGC
TGCCTGTGTCCTCTCCCTCCTCAATGTACGATCCAGGCCT
AAGCGAGGTTGGCGTTGGAGATGCCCAGTTCGAGAGCTCC
ATCGCCCGGCTCACAGCATCATGGGCGCCTGTGGCTCAGA
GCTACTGAGATCGCTTCACATTTAAGGACTGATGCTGCAG
TTATGGACTTGATCTTGGCTTCAGGAGGAAATCTAGAAGA
GCTTCTTGATTTGACAATCAGAAAACGGGTTGATTTACTA
TAAAAGTCACATCTGTATCATACCGAGGCATACGTATTTA
CAATCAAGATGAGAGACAATCAATTAAAGGGTTAGTTCTT
GCAAAAAAGAAAATTTTGACATCATTTACTCACCTTTGTT
TTAAACATTGTTAAGTTTTTATTCTGTTAAACACAAAAGA
AGATATTTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations