Transcript

tbxta-201

ID
ZDB-TSCRIPT-100915-726
Name
tbxta-201
Previous Names
  • ntla-001
  • ta-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046213 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046213|OTTDARG00000032979|ZDB-GENE-980526-437 ta|OTTDARP00000036469 ntla-001 LG_ CU633985.10 Danio rerio protein_coding KNOWN, 2211 bp
CGCTGTCAAAGCAACAGTATCCAACGGGATTTAGTAGGAT
CGTCGGACTTATCTCAAGCTTTATTTGATCGGAAATATGT
CTGCCTCAAGTCCCGACCAGCGCCTGGATCATCTCCTTAG
CGCCGTGGAGAGCGAATTTCAGAAGGGCAGCGAGAAAGGG
GACGCGTCCGAGCGGGATATTAAACTTTCGCTTGAAGACG
CGGAGTTGTGGACCAAATTTAAAGAGCTCACCAATGAAAT
GATTGTCACCAAGACTGGGAGACGAATGTTTCCCGTGCTC
AGAGCCAGTGTCACCGGTCTCGACCCTAATGCAATGTACT
CGGTCCTGCTGGATTTTGTGGCGGCCGATAATAATCGGTG
GAAATACGTGAACGGTGAATGGGTGCCCGGTGGGAAACCC
GAACCCCAAAGCCCGAGCTGCGTCTACATCCACCCGGACT
CACCCAACTTCGGCGCGCACTGGATGAAAGCACCCGTATC
TTTCAGCAAAGTCAAACTCTCCAATAAACTCAACGGAGGA
GGACAGATTATGTTAAACTCATTGCACAAATACGAACCCA
GGATACACATCGTGAAAGTCGGTGGGATTCAGAAAATGAT
CAGCAGTCAGTCTTTTCCTGAGACACAGTTTATTGCAGTC
ACAGCATATCAGAATGAAGAGATTACCGCTCTGAAAATCA
AACACAATCCTTTTGCCAAAGCTTTCCTCGATGCCAAAGA
GAGAAGTGACCACAAGGAAGTCCCAGACCACAGCACTGAC
AACCAGCAATCTGGATATTCACAACTCGGTGGCTGGTTCC
TGCCCAGTAACGGCCCCATGGGCCCCAGCAGCAGCCCTCC
TCAGTTCAATGGGGCCCCTGTTCACTCCTCGGGTTCGTAC
TGTGAGAGATACTCCAGCTTGAGGAACCACAGAGCTGCTC
CATATCCCAGCCATTACTCCCACCGCAGCACTACCACCAA
TAACTACATGGACAACTCTTCCGGAAGTCTTGCGTCTCAT
GACAGCTGGTCAGCCCTGCAGATCCCCAACTCCAGCGGGA
TGGGAACCCTGGCCCACACCACAAACACTACCTCCAACAC
CAGTCAGTACCCAAGTCTGTGGTCAGTTGCAGGGACGACT
CTCACCCCATCAGGCTCAGCATCGGGCTCCATTACAGGTG
GCCTGACATCTCAGTTCCTACGCGGTTCTTCGATGTCCTA
CTCGGGTCTGACCTCCTCGCTGCCTGTGTCCTCTCCCTCC
TCAATGTACGATCCAGGCCTAAGCGAGGTTGGCGTTGGAG
ATGCCCAGTTCGAGAGCTCCATCGCCCGGCTCACAGCATC
ATGGGCGCCTGTGGCTCAGAGCTACTGAGATCGCTTCACA
TTTAAGGACTGATGCTGCAGTTATGGACTTGATCTTGGCT
TCAGGAGGAAATCTAGAAGAGCTTCTTGATTTGACAATCA
GAAAACGGGTTGATTTACTATAAAAGTCACATCTGTATCA
TACCGAGGCATACGTATTTACAATCAAGATGAGAGACAAT
CAATTAAAGGGTTAGTTCTTGCAAAAAAGAAAATTTTGAC
ATCATTTACTCACCTTTGTTTTAAACATTGTTAAGTTTTT
ATTCTGTTAAACACAAAAGAAGATATTTTGAAGAATGTTC
AAAACTGGTAACCATTGCATAGAAGCTGTTTTACTTATGG
AAGTAAATGGTTACAGGTTATCAGCATTTTTTTAAATATA
TTTTTTAGTTCAACAGAAGAAAGAAACTCTTTAAAGTTTG
GAACAACTTGAGGGTGAGTAAATTGAGTAAAAGTACGTTT
TTGGGTTAACTATCCCTTTAACTATCAGATTTTAGCCATA
CATTTTGGGGCAATTATAGTGTTTATTCTTGATAATATTA
TCTAAAAGATTAATAAAATCAAAATTGTGCTGTTGACTCA
CTAAAAGTGTATATGTGTGTAAATAAATAGAAATTAACGT
CCGGTTTCATTGTATCACAGAAGAATGTAACAGTCTTACA
TGTGCTTTCTGTAGAACGAGAGAAAGACAGACTTTGCTGT
TTCGTTTGAGAAAGTGAATACGCTTTGAAAAGTGACCGTA
TAGTTTTGTCTGCTATTCGTCCTATAGAGAAACCATTTGT
ACATATCTATCTATTTGTATTTGTTGGGCTCTTTGAGTTT
TATTTATGTCATTTTAATAATAAATTAAATTTCTTTTTTT
TTTCTGTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations