Community Action Needed: Please respond to the NIH RFI
Transcript

insra-002

ID
ZDB-TSCRIPT-100915-513
Name
insra-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047633 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047633|OTTDARG00000019936|ZDB-GENE-020503-3 insra|no_translation insra-002 LG_ BX539340.7 Danio rerio protein_coding KNOWN, 784 bp
CTGCACTAAAGACAGCCAGTGCTGCCACGACCAGTGTCTG
GGCGGCTGTTTGGAGCCCCACTCGTCTAACAAATGCGTGG
CCTGCCGCAACTTCATGCACAACAACATGTGTGTCGAAAA
GTGCCCACATGGTTTCTACACCTTCAAGGGCTGGCGCTGC
GTCAGCTTCAGCTTTTGCCAGGAGCTCCACAACAAGTGCA
AGCAAGGCAAAGGTGACTGCCACGAATACGTCATTCACAA
CGGCGCCTGCATCCCTGAGTGCCCTTCAGGATACACCACT
GTCAACTCCACTACGTTGAACTGCACCCCTTGTGCTGGCC
TCTGTCCCAAAGTGTGCATGGGGTTGAAGACAGTGGACTC
GGTCACCGCGGCGCAGGCTCTGAGAGGATGCACTGTGATC
AATGGCAGTTTGGTCATCAACATCCGCGGAGGGAGTAAGA
ACAAACAAACTCTCTATAATACAATTTCTCTTCTTGGCAC
AGAACAAAAGGGCCTCTTTACTACAGGGCTCCAGGGAATT
CATGGTCTATGATTGGTTAATCAGCATTCTGCAAATGTTT
GTGTATTGTGAATAGCTAAACTGTGCAACTGGCTGTTTGT
GGCAGTCATTCTGCTATACTGTTAGTTTTAAGTGGCGTGT
AGTGTTTTGATCTCGTTACATATTTATTTTAATAACATAT
CACTCATTCTTGTATATTAATGTTCATTTCTTATGAACAT
TTGTTTTTATAGAATATTTTTGTAGTATTATCATTGTCAC
ATTTAATAATTGAAAAAAGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations