Community Action Needed: Please respond to the NIH RFI
Transcript

insra-201

ID
ZDB-TSCRIPT-090929-7525
Name
insra-201
Previous Names
  • insra-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024712 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024712|OTTDARG00000019936|ZDB-GENE-020503-3 insra|OTTDARP00000020377 insra-001 LG_ BX539340.7 Danio rerio protein_coding KNOWN, 6191 bp
CCTTGGAGAGAGTGGATATGTCACTGCACTTGCTACAGCC
AGCGTGGGGACAAACAAAATATTTTTCCATTCTTTTTCAA
CTAGTTTTTCCGCGGGAGTGTTAAAGACAAGAAATTGTCC
TCTGCGGAAACGGCTCGCTGTGTTGTATTGATCTGTGAAT
CAACACAAGTGCTCGCCAGCAACGCGACGTGGAAAGACTG
CATGTGGAGCTTTTGGGGTGGAAGTCTCGCGGAAATCTCA
ACGTTTGTCTTGTTTTTAGCATTCAGAGCCTGTGCTGTTC
ACAAGGCTCGCCGTGAGAGGAGGAACAGTACGAAGGAGAC
ACCGCGTGTAGTCCGGTGACCCGTGAACGGTGAAAGCTCG
CAGTCAGCAGAGACCTGGAATAAATACAAACTCAAATCTG
CCCAGTGTGAAGCCTGAGAGTCTTGAATATTTCGACAGAG
CCATAACTGCAATGTGCAATTTTCTAAACGGTTTATTTTA
CCGTAATAACTTTTGTATCTGAATAAAACAGTCCAGCGAA
CACAACAACAGAAAGTCTCTTGTAAACTCTATTGATTACT
TCGGCCTGCGCTCTGTGTGCGCAGCCATTCCACATCGCCA
GCTTTTTTACCCCATTTTTTCGCCAGGCTTGGGACAAACT
GCGCAAGTGCTGGACAAATACATTCAAGCTATCCGAAATG
ATGCGGCTGCTCATTTTAAATTATGCTTTATTCGTATGGA
TACAGTAAATGAAAGTCGCGGCCACGCGCTGTCATTAGCT
TAGCGCTCGTGCGCGTGTTCATATCAGCATCAGTCTGTGC
GCGCGACAGCAGAGCGGATTGAACACGTTGAACTTTCCTC
TCCGCCCATTTTTTTCAGAGGGGTGGGTGACAGGGTTCTT
TTCTTTTTAATTTTTATCCTTCTAAAACAACACCGGACTA
TTAAAACTGATCGTTACCCACAAGAAGACAAGTTCGGAGG
GGATTTTTGGACCGATTTTCGGCTTTACCGCGGGTCAAAA
TGCGGCTGCGGACTTTGATTGTTTTGGTTGCGTCTGTCTA
CACTGTTTGCAACTGTCAACAAACAAATGGAGAAATTTGC
TCAAGTAAAGACATCCGAAATAACGTGACCAACCTGCGGG
TGCTGGAGAACTGCACTGTTATCGAAGGCCACTTAAAGAT
CCTGCTCATGTTCACCACCAAACCAGAGGATTTCCGTGGC
CTGAGTTACCCCAAGCTGACAGTAGTGACGGACTACCTGC
TCCTGTTTCGTGTTTACGGCCTGGAGAGCCTCAGTGACCT
GTTCCCCAACCTAACAGTGGTGCGTGGCAATAATCTGTTC
TTCAACTATGCGCTGGTGCTCTTTGAGATGCTGCAGCTGA
AGGAGATCGGCCTTCACAGCCTGATGAACATCACTCGCGG
AGCCGTGCGTGTGGAAAAGAACCCGGACCTCTGCTACCTC
TCCACCCTCGACTGGTCCATGATCCTGGACTCTGTGGAGG
ACAACTACATTGTGGCCAATAAGAATGATCGGGAGTGTGG
AGACATCTGTCCAGGCACGGTTCTGGGCAAAACAACATGC
CCCCTCACCACTATCAACGGCGACTTCAGCGAGCGCTGCT
GGAACCAGAAGTACTGCCAGAGAATGTGTCCATCCTCATG
CAAGCACCGCGCCTGCACTAAAGACAGCCAGTGCTGCCAC
GACCAGTGTCTGGGCGGCTGTTTGGAGCCCCACTCGTCTA
ACAAATGCGTGGCCTGCCGCAACTTCATGCACAACAACAT
GTGTGTCGAAAAGTGCCCACATGGTTTCTACACCTTCAAG
GGCTGGCGCTGCGTCAGCTTCAGCTTTTGCCAGGAGCTCC
ACAACAAGTGCAAGCAAGGCAAAGGTGACTGCCACGAATA
CGTCATTCACAACGGCGCCTGCATCCCTGAGTGCCCTTCA
GGATACACCACTGTCAACTCCACTACGTTGAACTGCACCC
CTTGTGCTGGCCTCTGTCCCAAAGTGTGCATGGGGTTGAA
GACAGTGGACTCGGTCACCGCGGCGCAGGCTCTGAGAGGA
TGCACTGTGATCAATGGCAGTTTGGTCATCAACATCCGCG
GAGGGAATAACATAGCCGCTGAGCTAGAAGCTAACCTGGG
ACAGCTGGAGGAGATCACTGGTTACCTGACAGTGAGACAC
TCTTACGCCCTTGTCTCTCTGTCTTTTCTTCGCAAGCTCA
GAATCATCCATGGAGAGACACAAGAAGTCGGGAATTATTC
ATTTTACGCCCTTGATAACCAGAACCTGCGTCAGCTGTGG
GACTGGAGCAAACACAACCTGACCATCCAACAGGGTCGCA
TGTTTTTCCATCACAACTCCAAACTCTGCATGTCAGAAAT
CCGGAGGATGGAGGAGGTGACGGGTACCAAAAACAGGCAA
ACAAAGAATGACATCGTCTCAAAAACAAATGGAGATCAGG
CTTCATGTGAGAGCAAAGTTTTAAAATTCACCCGAATCAG
TACACTTTCTGACAAGATCATAATAAAATGGGAAGCTTTC
TGGCCACCAGATTTTCGAGACCTCCTAGGATTCATGGTTT
TGTATAAAGAAGCACCATATAAGAACGTGACTGAGTTTGA
TGGTCAGGACGCGTGTGGCTCTAACAGCTGGGTAATAGCA
GATGTGGACCCTCCACCTCGCGCCACAGAGGGAAAGGAGC
ACGAGCCTGGGTACCTCATCTTCCCTCTGAAGCCCTGGAC
GCAGTACGCCATCATGGTCAAAACACAGCTCTCTGCTTCT
GATGAGCACCAAGTCCACGGAGCAAAGAGTGAAATCATTT
ATGTCCGCACCAATGCTACCAAGCCATCAGTGCCTCTGGA
CCCCATATCCTCGTCAAACTCCTCATCCCAGATCATTCTA
AAATGGAAGCCACCAAACGATCCTAATGGAAACATCACTC
ATTACCTGGTCTTTTGCCAGCAACAGCCAGAGGCCAGCGA
GCTCTACAAATTTGATTACTGCCAGAAAGGTATGAAGCTG
CCCACCAGAGCCCCCACACAAGTGGACAACGAAGAGGAGC
AGAAGTGGAACCAAACTGAGGAGCAGGGCCCTGATAGCCG
CTGCTGCGCTTGTCCTAAAACAGAGAAACAACTGAAGAAA
GAGGCGGAAGAGACGGAGTATCGAAAAACCTTTGAGAACT
ACCTCCATAATGAAGTGTTTGAGCTCAGGCCATCAAGACA
GCGCAGATCTCTGGTGGGCATTGCTAATAGGACGTCCTCT
CGTCTTTTCACCACACCCTCCTCACTCCCCAATGGCTCTG
CTACTCGTAGCCCAGAAGAGGAAGCAGAGGCCAACAAGAT
TTCACTGATTGTTCAGGCCAAGGAGTCAACAGTCATCTCC
AATCTACGGCATTTCACCAGCTACCAGATAGAAATCCATG
CATGCAACCATGGCAGTGACCCGACTCGATGCAGTATGGC
AGCCTACGTCAGTGCCCGCACCATGCCTGAAGAAAAAGCT
GATGACATTGTGGGAAAGATCACCTGTGAGGTGTTCGAGT
ACTCTGTGCACATCAGATGGATTGAGCCCAAGGCCCCTAA
TGGCATGATTATTCTCTATGAAGTCCATTACAAGAGACTG
GGAGATACAGAGGAGCTGCACCACTGCGTATCCAGGAAGA
ATTATATTGCAGACGGAGGGTGCAAGCTGAGAGTGGTGCA
TCCTGGGAACTATACAGTGCGGATCAGAGCGACCTCTCTG
GCAGGCAATGGATCATGGACAGAGCCAACACACTTCTATG
TGCAGGACCTACGTGTGGATCCATCCAACGTGCTGAAGAT
TGTGATTGGTCCAGTTATATGTTTTTTTCTGCTCCTATTG
TTATGTGTGGGCTTTTACATAGTCAAGAAAAAGCAAACAG
AAGGTCCGACCGGCCGACTTTACACATCTCCAAATCCAGA
GTATTTCAGTCCAGATGAGGTGTATGAGCCGGACGAATGG
GAAGTGCCCCGTGAAAAGATCACTCTATTGAGAGAGTTGG
GCCAGGGATCTTTCGGTATGGTTTATGAGGGCAATGGAAA
GGACATAGTGAAAGGAGAGTCGCAGACGCGTGTGGCGGTG
AAGACGGTTAATGAGTCTGCCAGTCTCAGAGAGAGAATTG
AGTTCCTCAATGAAGCTTCTGTCATGAAGGCCTTCAGCTG
CCACCATGTGGTGAGGCTTCTGGGAGTGGTGTCTAAAGGC
CAGCCAACTCTGGTGGTGATGGAGCTCATGACACACGGTG
ATCTGAAGAGTTTCCTGCGCTCTCTCAGACCTGACTCAGA
GAATAACCCAGGCCGGCCTCCTCCGACTCTGAAGGAGATG
ATTCAGATGGCCGCAGAGATAGCAGATGGCATGGCTTATC
TTAATGCCAAAAAGTTTGTGCACAGAGATCTTGCTGCCAG
GAACTGCATGGTGGCCGAAGACCTGACTGTAAAAATTGGA
GATTTTGGCATGACCAGAGATATTTATGAGACGGATTACT
ACAGAAAGGGTGGGAAGGGTCTTCTTCCAGTGAGATGGAT
GGCACCAGAGTCGCTGAAGGATGGTGTTTTCACAGCTCAC
TCAGACTGCTGGTCGTTTGGTGTGGTGTTATGGGAAGTCA
GCACTCTGGCTGAACAGCCGTATCAAGGCCTGTCCAATGA
ACAGGTCCTTAAATTTGTGATGGAAGGAGGATATCTGGAC
AGACCAGACAACTGCGCAGACAGATTACATAACCTGATGC
AGATGTGCTGGCATTATAATCCCAAAATGCGGCCCACCTT
CCAGGAGATCATCGAGATGCTCCGCGAAGATCTGCATCCC
TCGTTTCAGGAGGTCTCCTTCTTCTACAGCGAGGAAAACA
AGCCACCGGAAACAGAGGAGTTTGACATGGACCTGGAGAA
CATGGAGAGCATCCCGCTGGACCCGTCCTCGTACTCACAG
AGGGAGTGCTGTCTGGACGGGGACGAGGGCTCCTCCGTGG
GCCTTCGGGGCAGTTATGAGGAGCATGTGCCGTACACGCA
TATGAACGGCGGCAAGAAAAACGGACGCATCTTATCTCTA
CCCCGATCCACCCCTTCTTAATATCACTAACCCCATTAAG
CTATATAGGTTTTTTTGTTTTGTTTTTGTCATCATTTTAT
AGATTTACTTTTTATCGAGCTCTATATCAGAAGCACTTCA
GAAAGTAATCTCAGGACATTTGTTTTCTTCTTTACTGCCT
CTGTATGATGATGATGATGATGATGATGATGATGATACAA
GGAGCAGGCATTGTTTTGGATTTTTTTTTTATATTTAAAG
AAGAAAACACCCATCAACTGCTTCTCTTCTGATGTTTCTT
TTAATATTGCCAAGTTTCAAGAACTGGTCAAATGGAACAA
ACTGTGAAATGAACCTCAACAACCCGAAGGCTGCTTTAAA
CCTTACATCTCCTCAGACTCTCTCCTCATCCGCCAACGGA
TTCTCCTCAGATTTCTCCAGAAAAGACAGAATGTTTATGA
AGCATATGAGGGGGAAAAAGTGACCTTACCCTGCTTGTGG
CCTGTGTCATGACTAACGTGGAGTTGTGTCTGAATCTGTC
CACCTTTGGTAATGGTTTTGGCAAACCTGTTGAACTTGGG
AAATGTAAGGATGACTTTTCTCATCCATCCAAGAACAAAC
TGTGCACAGGTGAAGCCTGTAAAAGACAGTGCTTTTCTAT
CTGCTACTCAGTATTCCAGACTACACAGAGAGCGAACAGA
TTTTTGGACTCTATTTTTTTATTTATTTGCGTACCTGTGC
TCCTTCTCCACTTGTTCCCTGCCCTCCTGGTGTTCACACA
TTTACAGCTGAAGGATATTTAAACTGTTTTCAGGACTTTG
GACTAAGAGAGTTCTTCAGATTGACCAATAGTTGCTGCTT
TGATATATTTTAGTGGGTATAGATGATGACAAACAAAGTA
TATATAAATATATTATTGATGTTTTTTGTACATAGATGAT
ATGTCGTCATTCGAGAGCTCTTGCCCGGTTGTAGAAATGT
TTTTACATGTTTGTCTCGAATCTTTATTTTTTCTAATTGA
AAATCGTACTAATCATTCTGGACCTCTGATCAGCCCAGCA
GCTCCAGATGCACAGGAGTGTCGAGACACTTTCGGCTCTC
GTGGCCAATCTTGATATCAATGGAAATAACTGCTGTAAAT
AAAGCAGTGAGGTGCATTCAAGAAGAGCGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations