Transcript

tp63-204

ID
ZDB-TSCRIPT-100915-1516
Name
tp63-204
Previous Names
  • tp63-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047332 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047332|OTTDARG00000019803|ZDB-GENE-030819-1 tp63|OTTDARP00000037189 tp63-003 LG_none BX004773.11,BX004878.8 Danio rerio protein_coding KNOWN, 2497 bp
GTGTTGTTAATCACCAATCCTAATTCTATAAGATCCAGGG
GCTAGCTTCTAGTGGTTGGATGTACTTATTCAATGTTTTT
GAAGACTGCATCATCATGGTCATCTCTGCAGTGCGGTCAG
ATCCTGGAGGTCCTTTAGCTTTACCCAAGCAGCATGTCAT
CTCCTTTTATTGAGAGAACCAGCAGCAGCGTGTCTGTCAT
GGGCTGAAGGTTCTTTTCTGGCCTCCATGTCACAGGGCCA
GGGCTCTCAGGGTACAGATATTCTTGGGCAAGACGTCCTC
AACCAGTTACTGGAGATGTTGGACCAGTCTGCATTACATT
CAATGCAGCCTATCGAGCTCAATTTCTCTGAGGGCTCTTC
GGTCGGATCAGCATCCAATACTATACAGATTAGCATGGAC
TGCATCACAATGCATGGGCCTGAGGAGCCCCTTACACCTC
AGTATACAAGCCTGGGGCTTCTCAACAGCATGGATCAAAA
TGGGGGCTCCACATCCACCAGCCCCTACAACAACGATCAT
GCTCAAAACAATGTGACGGCACCATCGCCCTATGCCCAGC
CCAGCTCCACCTTTGAAGCCCTCTCTCCATCACCTGCCAT
CCCATCCAACACAGACTACGCTGGCCCACACACCTTTGAT
GTGTCCTTCCAGCAGTCCAGCACAGCCAAATCTGCAACCT
GGACGTACTCCACAGAGTTGAAGAAGCTGTACTGTCAGAT
TGCCAAAACATGTCCTATTCAAATCAAGGTCCTAACCAAC
CCACCCCAGGGTGCAGTCATACGGGCCATGCCTGTCTATA
AGAAAGCAGAGCATGTTACTGAGGTGGTCAAACGATGCCC
GAACCACGAGCTGAGCAGAGAGTTCAATGACGGCCAAATA
GCCCCACCCAGTCACCTTATTAGGGTTGAGGGGAACAGTC
ACGCTCAATACGTGGAGGATTCCATTACTGGGCGTCAAAG
TGTGCTGGTGCCTTATGAGCCCCCTCAGGTGGGCACAGAG
TTCACAACCATCTTGTACAATTTCATGTGTAACTCCAGCT
GTGTTGGCGGAATGAACAGGCGGCCAATTCTCATCATTGT
CACATTGGAAACCAGAGATGGTCAGGTTTTGGGTCGACGG
TGTTTTGAGGCTCGTATCTGTGCGTGCCCTGGACGTGACC
GCAAAGCTGACGAGGACAGCATCCGCAAACAGCACGTCAC
CGATGGCACAAAGAGCAGTGAGGCTTTCCGTCAAGCCTCT
TCTCACCTATCCCAGCTAAACTCCATCAAGAAACGAAGAT
CTACAGACGAGGAAGTGTTTTGTCTGCCTATTAAAGGCCG
TGAAATCTATGAGATTTTGGTGAAAATCAAAGAGTCTTTG
GAACTCATGCAGTTCCTCCCTCAGCAGACTATTGAGTCAT
ACAGACAGCAGCAGCAGAACCTACTGCAGAAACAGAGCTC
TCTGCCACCCCAGCCTGCATTCGGCTCCAGCTCGCCCACC
CTCGGCAAGAACAAACTGCCCTCTGTCAGTCAACTCATCA
ACCCCCAACAGCGCAACGCTCTCACCCCATCCGGCATGCC
AGGAGGACTCACTGACATGACCCCTCCTATGATGGGTGGC
CCTGTTCCTATGAACACAGACCTGAGCTCCTTGAGCCCCA
ACAACCCCCTCCAGTCACAGTTACAAATGGTGCCTTCATC
CCACTGCACACCTCCACCACCCTACCCGATGGACAACAGC
ATTTCCAGTTTCCTGTTGAGGCTGGGCTGCTCGGCCTGTT
TGGACTATTTCACAGCCCAAGGACTGACCAATATCTACCA
GATTGAGAATTATAACTTAGAGGACTTGTCCAGGCTGAAG
ATCCCCACAGAATTCCAGCACATCATCTGGAAAGGCATCA
TGGAGTACCGGCAGACCATGGAGTTTTCTCCCCCTCCCCA
CATCTTGCGCACCTCTAGCGGGACATCCACTGTCAGCGTG
GGCTCCACTGAAGCCCGAGGCGAGCGCGTGATCGACGCCG
TGCGCTTCACCCTCCGTCAGACCATCTCCTTCCCTCCGCG
GGATGACTGGACCGATTTCTCCTTCGATCTGGCCCCTGAT
TCACGCCGCAACAAGCAGCAGCGCATCAAGGAGGAAGGAG
AATGAACAGAGTACATGACTGTACACAATACAACAACAGT
GCACATTTACTGTACACACACACACACATGCGCGCTCTGT
TTTATAGAAACACACTTGGTGTTGGTCCAGATCGTTTCAC
AGGTTTCTTCTGCAAGTGATGATTTCAAAAAAGAAAAGAA
AAAAAAAAAGCTGTGAGCCTCATAGTCTAGTTCACTTAAA
CGGGCAGATCAAATGCACTTAAGTCCTTTTATAGTTTCAT
TTTGCTTCTGATGAATTTATCTGGATGTCATTTCAAGACC
CTCCTACTTTTTTTTTTGGACCGCAAGCAGCTCTGGCTGA
GGGGAAATGGTGCTTTGCTAAATTGTGCTGTCATTTTTTT
TCCTGTTTCTCGAGACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations