Transcript

tp63-205

ID
ZDB-TSCRIPT-100915-1001
Name
tp63-205
Previous Names
  • tp63-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047334 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047334|OTTDARG00000019803|ZDB-GENE-030819-1 tp63|OTTDARP00000037191 tp63-004 LG_none BX004773.11,BX004878.8 Danio rerio protein_coding KNOWN, 1731 bp
ATGTTGTACCTGGAGACCAATGCTCCCTCATCCTACAGCG
AGCCTCAGTATACAAGCCTGGGGCTTCTCAACAGCATGGA
TCAAAATGGGGGCTCCACATCCACCAGCCCCTACAACAAC
GATCATGCTCAAAACAATGTGACGGCACCATCGCCCTATG
CCCAGCCCAGCTCCACCTTTGAAGCCCTCTCTCCATCACC
TGCCATCCCATCCAACACAGACTACGCTGGCCCACACACC
TTTGATGTGTCCTTCCAGCAGTCCAGCACAGCCAAATCTG
CAACCTGGACGTACTCCACAGAGTTGAAGAAGCTGTACTG
TCAGATTGCCAAAACATGTCCTATTCAAATCAAGGTCCTA
ACCAACCCACCCCAGGGTGCAGTCATACGGGCCATGCCTG
TCTATAAGAAAGCAGAGCATGTTACTGAGGTGGTCAAACG
ATGCCCGAACCACGAGCTGAGCAGAGAGTTCAATGACGGC
CAAATAGCCCCACCCAGTCACCTTATTAGGGTTGAGGGGA
ACAGTCACGCTCAATACGTGGAGGATTCCATTACTGGGCG
TCAAAGTGTGCTGGTGCCTTATGAGCCCCCTCAGGTGGGC
ACAGAGTTCACAACCATCTTGTACAATTTCATGTGTAACT
CCAGCTGTGTTGGCGGAATGAACAGGCGGCCAATTCTCAT
CATTGTCACATTGGAAACCAGAGATGGTCAGGTTTTGGGT
CGACGGTGTTTTGAGGCTCGTATCTGTGCGTGCCCTGGAC
GTGACCGCAAAGCTGACGAGGACAGCATCCGCAAACAGCA
CGTCACCGATGGCACAAAGAGCAGTGAGGCTTTCCGTCAA
GCCTCTTCTCACCTATCCCAGCTAAACTCCATCAAGAAAC
GAAGATCTACAGACGAGGAAGTGTTTTGTCTGCCTATTAA
AGGCCGTGAAATCTATGAGATTTTGGTGAAAATCAAAGAG
TCTTTGGAACTCATGCAGTTCCTCCCTCAGCAGACTATTG
AGTCATACAGACAGCAGCAGCAGAACCTACTGCAGAAACA
GAGCTCTCTGCCACCCCAGCCTGCATTCGGCTCCAGCTCG
CCCACCCTCGGCAAGAACAAACTGCCCTCTGTCAGTCAAC
TCATCAACCCCCAACAGCGCAACGCTCTCACCCCATCCGG
CATGCCAGGAGGACTCACTGACATGACCCCTCCTATGATG
GGTGGCCCTGTTCCTATGAACACAGACCTGAGCTCCTTGA
GCCCCAACAACCCCCTCCAGTCACAGTTACAAATGGTGCC
TTCATCCCACTGCACACCTCCACCACCCTACCCGATGGAC
AACAGCATTTCCAGTTTCCTGTTGAGGCTGGGCTGCTCGG
CCTGTTTGGACTATTTCACAGCCCAAGGACTGACCAATAT
CTACCAGATTGAGAATTATAACTTAGAGGACTTGTCCAGG
CTGAAGATCCCCACAGAATTCCAGCACATCATCTGGAAAG
GCATCATGGAGTACCGGCAGACCATGGAGTTTTCTCCCCC
TCCCCACATCTTGCGCACCTCTAGCGGGACATCCACTGTC
AGCGTGGGCTCCACTGAAGCCCGAGGCGAGCGCGTGATCG
ACGCCGTGCGCTTCACCCTCCGTCAGACCATCTCCTTCCC
TCCGCGGGATGACTGGACCGATTTCTCCTTCGATCTGGCC
CCTGATTCACGCCGCAACAAGCAGCAGCGCATCAAGGAGG
AAGGAGAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations