Transcript

hnrnpk-205

ID
ZDB-TSCRIPT-091203-65
Name
hnrnpk-205
Previous Names
  • hnrnpk-006
  • hnrpk-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045686 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045686|OTTDARG00000020495|ZDB-GENE-040426-1926 hnrnpk|OTTDARP00000036062 hnrpk-006 LG_none CR376792.13,CU682767.30 Danio rerio protein_coding KNOWN, 551 bp
ATTGTTGTTACGAAGGGGGAGTACGATAGGAACAGCTATT
TGTGTTTTCCTCTAGGCATTTGTTTGGACAGAGAGGGCTG
TTCATCTCCACTAGGTGTAGATAGATAATGGATCCAGAAA
ACGACCCACAGGAAGAGGAGACTTTCAGCAACAAAGAGAG
TAATGGTAAGCGTTCTGCTGATGATTCAGAGGAGGAAAAA
CCCTATAAGAGATCCCGAAACTCTGACGAAATGGTGGAGC
TCAGAATTCTGCTACAGAGCAAAAATGCAGGCGCTGTGAT
TGGAAAGGGTGGGAAAAATATTAAAGCTCTGCGCACAGAT
TACAATGCCACTGTGTCAGTCCCAGACAGCAGTGGGCCCG
AGCGAATCCTAAGCGTCAGTGCCGATATTCCTACGGTGGC
TGAGATATTGCTGAAGATCATACCTACTCTTGAAGAGTAT
CAGCATCACAAGGGTGTGGACTTTGACTGTGAACTGAGGC
TCCTCATTCACCAGAGCTTAGCTGGCAGCATCATTGGACT
GAAAGGAGCTAAGATTAAGGAACTGCGTGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations