Transcript

hnrnpk-003

ID
ZDB-TSCRIPT-090929-8382
Name
hnrnpk-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025663 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025663|OTTDARG00000020495|ZDB-GENE-040426-1926 hnrnpk|no_translation hnrpk-003 LG_none CR376792.13,CU682767.30 Danio rerio protein_coding KNOWN, 891 bp
TTTTTTTTGGCATTGAGAAGACAAAAGAGTGGCCCAATTG
ACCCAAATCCAGTAAACATTATTAACTTCTTCCCCTTAAA
TCAGATAGTAATTCGTCTTGGGATTCCTCCTATCAGTCTG
GTGAGTGTTTCATCCTGTTGGGCCAGCTGTTTTGTCGTGT
CCAGTTGTAAACCTCTCATTTTAACACGTTTTTACTGTCT
CCATGTGCTCAGGTGGAAGGAGCAGTTACAGTGACGGTCC
TGTGATCACCACACAAGTGACTATTCCTAAAGATCTGGCG
GGATCCATCATTGGTAAAGGAGGACAGAGGATCAAGCAGA
TTCGCCACGAGTCTGGAGCGTCAATCAAAATCGACGAGCC
CCTCCAGGGTTCAGAGGATCGCATCATCACCATCACAGGA
ACCCAAGACCAGATCCAGAACGCTCAGTACCTGTTACAGA
ACAGGTATGATCTTCATTCAGTTCATTTCACCAGAGAGCA
AAGAATCACCAAGAGGCGATACTCTAGTGCGATTTGGGGA
AACGGCCACTAGATGGCGTTGCGGCTATTTTGAAGTGAAC
ATTTCAATAGAACAACAGAGTATTATAAGTCTGTAAAATA
AGCTATTAAAAGTGCAGATGATTGTGATGGTAAGTGTTGA
ATTGTCGTCTTTCAGGTTGCTTTAATGCTCTTTTTAAATA
AATGAATAACAAAGCAGCTGCTTTCCATCCCGACAGCAAA
ATGATTCAATAGACAGCCGACTGCTTTCACTCCAAAACGG
CGGAATCGGAGGCTGTTGAAGGGCTCTGCTGTTGCAATTG
AATGTTCTGTTCCAACATGATAAATGTCAATCAAAGGCGG
CAACACCAAGGCTCCAAAAGTACAAATTTATTCAATTAAA
AAGGCTGACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations