Transcript

mpx-202

ID
ZDB-TSCRIPT-091110-831
Name
mpx-202
Previous Names
  • mpx-001
  • mpx-002
  • ch211-199i18.6-001
  • ottdart00000042921
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042921 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042921|OTTDARG00000030890|ZDB-GENE-030131-9460 mpx|OTTDARP00000034069 mpx-002 LG_ CU681843.6 Danio rerio protein_coding KNOWN, 3199 bp
ACAACTTACTCTGAGCTTCAAGTCCAGAACCAGTGAGCCT
GAGACACGCATGTTTTACTGAGATGAATCTTCCCACTTTT
CTTTTTGTGGTGGGCTGCTGTTGTGCTCTTTCAATGGGGG
CAGAAGAAGAGAGTCCTGGAAGACCTTTTATTCTTGATTC
AATTGAGGAAGCAAAGAAAATAGTAGACGCTGCTTACAAG
TATTCTCGAGATGAGAGTTTAGCAAGGGTGCGCAAAGATG
TCATTAAGCCTTCTGACAAGCTACGTCTGTTGAAACAGCC
AGCTCGAAAGACACGGGAGGCCGTAAGAGCTGCAGACTAC
ATGGCACAAACGCTGAGACTGATCAGTGAGAAAGCCCATC
ATGTACACAAGAGGTCCATCAATGCCACAAACCTGCTCAC
TCAAGACGAGCTTCAAACCATTACACGTATGACAGGCTGT
GAAGCTCAAACCCGGCCACCATCTTGTAGGACCACACCCC
TCATAAACAAGTATCGAACTGCCAGCGGTGTCTGCAACAA
TCGGAAGAACCCACTTCTTGGTGCATCCAACACTCCATTT
GCCCGCTGGTTGCCTGCTCAATATGAGGACGCCGTTTCTC
AGCCAAAAGGATGGGATCCCAACAAGTTGTACAATGGTGC
AGCGCTGCCCATGGTTAGACTGGTTTCCAATCGCATTCTA
GCCACTGCAGATGCTGACATAGAGAGTGACCATGACTTTA
CCTTCATGCTCACCATCTTTGGGCAATGGGTTGACCACGA
TCTGACTTTTACACCTTTCTCACCAAGTATTAGGTCCTTT
AGTAATGGCATTGACTGTGAAAACAGTTGTGAGCGCTCTG
AACCCTGCTTCCCAATTTCGGCCCCTCCAGGAGATCAGCG
TCTGCGCCCTAACACCTGTCTCCCTGTCTTCCGGTCAGCA
CCGACTTGTGGTTCTGGGCACACTGCCTACATGTTTGGTG
AAGTCCCAAATGTTCGGGAACAGATCAATACTCTAACAGC
TTACCTAGATGCTGGACAAGTTTACGGTTCAGAGGATGGA
CTAGCAAAGGAACTGCGGGACCTTACTAATGATGGTGGCC
TTTTACGTGTTAATAATCGTTTTAAAGACAATGGACGAGA
GCTCCTGCCCTTTACTAGTGTTAACACCAACTTGTGCGCC
ACTCGTCAGAAAATCCTCAACGACAGCACTCTGACAGAGG
TTCCTTGCTTCATTGCGGGTGATGCTCGTGTCAATGAGAA
TCCTGCTCTGAACTCCTTACACACACTTTTTGTAAGGGAG
CACAATAGATTGGCTCGCGCCCTTCATGTGCTCAACCCTA
CCTGGAGTAGTGAAACTCTTTATCAAGAAGCAAGAAAAAT
TGTCGGTGCATTCAACCAGATCTTGGTGATCAAGGAATAC
TTGCCACTAATTGTAGGCCCTGATGCTTACAATAGACACC
TTGGACCATATCCAGGTTACAATGAGAATGTAGACCCTAC
CATTGCGAACGTCTTTGCCACTGCTGCTTTCCGTTTTGCC
CACTTGACTATCCAGCCCTTCATTTTTCGTCTTGATGAAA
ACTACAAGAACCATCCTCAGTTTCCCAGTGTCCCCCTCTA
TGAGGCTTTCTTCTCTCCATGGAGGGTGATCTTTGAAGGG
GGCATTGATCCTGTGCTCCGTGGACTGATTGGTCGTCCGG
CAAAACTGAACACCCAGGACCACATGTTGGTGAATGCTCT
CAGAGAGAGGCTGTTTGCCTTCACATCCCACATAGCTTTG
GATCTGGCTTCCCTCAACATGCAAAGAGGGCGTGACCATG
CTATACCAGGTTATAATGCATGGCGTCGGTTCTGTGGATT
GTCTGCTCCTCAGAATGAGCAAGAATTGGCTGTGGTGATG
AACAACACTGAACTAGCCCGCAAGTTAATTGAGCTTTATG
GCACCCCTGAGAACATTGATGTTTGGTTAGGAGGTGTTGC
TGAGCCTTTTGCTCCTGGTGGTCGTGTCGGTTCTCTTTTT
GCCTGCCTGATTTCAAGACAGTTCCAGAAAATCCGAGATG
GCGATAGGTTGTGGTTTGAGAGCAATGGAGTGTTCACCAC
CAAACAGAAAACAGCTCTGGCCTCTGTGTCGCTGGCCCGC
ATAATCTGCGACAACACCGGAATCCTTAAAGTTCCCAGAG
ATCCTTTTCGCTTCCGGAGTCCTGCCAATTTTGTTAACTG
TGGGAATATCCCAGCTTTTGATCTCGAGCCTTGGAAAGAG
ACTGGTGATGGTGGCATCAACATTTCAGACATTGGAAATG
AGATAGAGATTCCATCCCAGGACCTCCCGGACCCAGGGGA
CCTCCAGGAGAACGTGGTCCACAGGGTGTAGCAGGGCCAC
CAGGACCTCCAGGAATTCCAGGACCTCCCATTAATACAAC
AGGACAACAGTCTGCCTTCTTTGCCTCAGTCAACTCCATC
CTTCCTGCCACTGCTAAAGTTGTGGTGTTCGGTCAGGTCC
TTTACAATGGACAAAACCATTATAACCAAACCTCAGGGAT
GTTCTTGTGCCAGATACCTGGTGTATATGAATTCGAGTTT
TCATGCATAGGGACTCGTAGTTTGGGCTTTGTGACCTTAA
AGAAAAATAATAGGGTAGAGCTTACTCCTGAAACAGTTGC
TCTTAATACAAGGTCATTAGCTGAAGGGAAGGCAGTCCTG
AGCCTACAGAGAGGAGACCGTGTGTATGTGGAGGTTTCTC
GAAGTGCTAATGGTATAGGCTTTTCAAGCTATTTCTCTGG
CCACATTCTTTTTCCCGTTTGAGGCTATTACTTATAATGC
ATTACTATTTCCCTTTTTTTTTTGTTCATTTTAAATGCAT
TCTGCTTCTTTCTATTTGTCTTTAAACATGTTTCTTCTTA
CTGTAATGTCTTAGGCTCTGTTGTTGTTGTTGTTGTTTTA
TTAATAATTAGCTTTGCAAAATTAGTAGTATGGTTAGAGA
ATGCCTTATGTTTTAATTCAGAATTTTTTACAGGTAAATA
AGTGATAAAATTTCAGAACCAAGATTTAACTGCTAATGCA
TTGACCTTTCTTTTATGAAGTTTTTTTTTTTATTTGTTGT
TTTTGGTTTTGTTGTCAGATTGCAACAAAATTTTCGGTAG
TCCATGCTGTGACAGTTATTTTTGTGTATGCTTTTAGCAA
AGTAAAAAAACTAATAAATAAAGTTTTTTGTCAATATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations