Transcript

mpx-003

ID
ZDB-TSCRIPT-091110-101
Name
mpx-003
Previous Names
  • dkey-180g13.1-001
  • ottdart00000042923
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042923 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042923|OTTDARG00000030890|ZDB-GENE-030131-9460 mpx|no_translation mpx-003 LG_ CU681843.6 Danio rerio protein_coding KNOWN, 1481 bp
GCTTTCCGTTTTGCCCACTTGACTATCCAGCCCTTCATTT
TTCGTCTTGATGAAAACTACAAGAACCATCCTCAGTTTCC
CAGTGTCCCCCTCTATGAGGCTTTCTTCTCTCCATGGAGG
GTGATCTTTGAAGGGGGCATTGATCCTGTGCTCCGTGGAC
TGATTGGTCGTCCGGCAAAACTGAACACCCAGGACCACAT
GTTGGTGAATGCTCTCAGAGAGAGGCTGTTTGCCTTCACA
TCCCACATAGCTTTGGATCTGGCTTCCCTCAACATGCAAA
GAGGGCGTGACCATGCTATACCAGGTTATAATGCATGGCG
TCGGTTCTGTGGATTGTCTGCTCCTCAGAATGAGCAAGAA
TTGGCTGTGGTGATGAACAACACTGAACTAGCCCGCAAGT
TAATTGAGCTTTATGGCACCCCTGAGAACATTGATGTTTG
GTTAGGAGGTGTTGCTGAGCCTTTTGCTCCTGGTGGTCGT
GTCGGTTCTCTTTTTGCCTGCCTGATTTCAAGACAGTTCC
AGAAAATCCGAGATGGCGATAGGTTGTGGTTTGAGAGCAA
TGGAGTGTTCACCACCAAACAGAAAACAGCTCTGGCCTCT
GTGTCGCTGGCCCGCATAATCTGCGACAACACCGGAATCC
TTAAAGTTCCCAGAGATCCTTTTCGCTTCCGGAGTCCTGC
CAATTTTGTTAACTGTGGGAATATCCCAGCTTTTGATCTC
GAGCCTTGGAAAGAGACTGGTGAGACATCATACAGTACCT
TTTAACTGCTGCATGCTTATACATAAATCTTCTGGGGATG
CTTAAACGTAAACCTTCTGCTTGTACATAAATCTCAGCCT
AAACTTCCTGATTGCTTTATATGTGCTTGTAGAGTACCTA
ATTTTGGTGGTAAAGGCACATATAAAGTATTGCATATATC
ATGGTACGGTGACCATGGTTTAGTTCACCTGTGATTTGGT
GTTTGACCTTCCAGGTGATGGTGGCATCAACATTTCAGAC
ATTGGAAATGAGGTTAGATGAGTGTTTATTCTCTCCCAAT
CCAAAAGAGAAAGTTTTTTTTTATTATTTCACTACAAATC
TGGACAAACTAAGAAGCTTCTTTGCTGTACAATGGTTTGG
TGCAGTGATATTTATTAATGAATCTGGATGTAACAACTGT
CAAGCTGTATTTTATGACTGCACTAAACTATTGCAAGCTG
TTAACCTTTTTCCTAGCCTTTCATTGGTTTAAGGGGATTT
GCTTCAAATTGAAAACAAATGCTTTGTTGTTGTTTAATGA
CAATTCTTAGGCTTGTAATACTAACACATTACATCTTTTT
ATTGCTACACAGATAGAGATTCCATCCCAGGACCTCCCGG
ACCCAGGGGACCTCCAGGAGAACGTGGTCCACAGGGTGTA
GCAGGGCCACCAGGACCTCCAGGAATTCCAGGACCTCCCA
TTAATACAACAGGACAACAGTCTGCCTTCTTTGCCTCAGT
C

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations