Transcript

slbp-201

ID
ZDB-TSCRIPT-091110-612
Name
slbp-201
Previous Names
  • slbp-001
  • ch211-150d5.2-001
  • dkey-102m7.2-001
  • ottdart00000044963
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044963 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044963|OTTDARG00000032236|ZDB-GENE-030131-9686 slbp|OTTDARP00000035561 DKEY-102M7.2-001 LG_ BX323828.7 Danio rerio protein_coding KNOWN, 1331 bp
ATCGATGTTGACGTACACTGCAGGACATTGGCGCGGTTTA
ATCCAAACCCGGCAGCTGATCGTACGTGCAGGTTCAATTT
TACACCCTCTCGAAGCAATGTCTGAACAACAAAAATACAA
ATACGAAAACGATTACAAATCTAGTGAAGACAGGAACAAA
GGAGCTTCAAGGTGGTCACAGTGTAGGAAACGTGGAGCAG
ATGGTATTCTGAGGAAGTCTCATGCTGATGAAGAGCCAGG
CAAAGATCAAAGATGTTCGAAGAGATCAGAAAGTTTTACA
ACCCCAGAGAGTGAAGGACCAGTGTCCAGAATAAAAAACT
GGGGCGATGAGGTGGAGGAACAGGAAATGCGCACAAATGT
CCGGCGTGATTTTCATCGTTACAGAAGGAGGATTCTTGCG
AGTGATTTCCCTCAAAGAGACAGAAAAATCTCATCTGGAA
GTTCAGACTCCAGAGACTCTAGGGATTCGAAAGAGTCGCC
TGCTAAAGGTGACATCGAGACCGATGAGACCACCCTCATC
AGAAGACAGAAGCAGATAAATTACGGGAAAAATACTCTTG
CGTACGACAGATACATTAAAGAAGTTCCAAAGCATTTGAG
ACAACCAGGTGTTCATCCAAAGACTCCAAACAAGTTCAAG
AAGTACAGCAGACGCTCCTGGGACCAGCAGATTAAATTGT
GGCGGGTCAAACTTCATGCATGGGACCCTCCTGCAGAAGA
GGGAAGCGACTTTCAGCAAATAGAGGAGATCGACCTTGGT
GAAATTATGGACTTTGAGTTGGATGTGGAAACGACAGAGA
ATACTGAATCCCAATGCTCATCAAGCAATGGAGCAGCACA
GTCTTTACAAGAGGACGCGTTCATGGAAACACCGAAAAAG
ATGATGAAAATTGAGGATTCCGACATGTCTTGAGCAGCTA
CACTGAGTGTCTATGAGAGTATTACTGAGCAGCTGAACTG
TTTTAATGCACTGTTTGTTTTGAGCATCATTGTTTCCAAC
AGGTTCTGATGTTTTTGTGATGACAGGTTTTGACAGCTTC
TTAAAGAGAAGGTTTTGTCATCATCACTGAATTCACCGTT
CTCCACTTTTCTTTTTCGGGTCTTTGGAAGAAAATGTAAA
TGTGTAAATTTTTGGAATTGTTTAATTTTTATTGTGGAAA
TCTGTTTAGTGCTTGGTAAACATTCTCTTGTATTTATCAA
TTTGTTGAATCTCTGATTACAGCAAATATCATATTTTGTA
GTTTGTGATTTTAAATGTTCTTTTAGTTCATTTCTTTTTT
TTTAATTAAAAACCTTTTGAAAATAAATATTAAATTGGAA
TGACCAAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations