Transcript

slbp-003

ID
ZDB-TSCRIPT-091110-2059
Name
slbp-003
Previous Names
  • dkey-102m7.2-002
  • dkey-102m7.2-003
  • ottdart00000044965
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044965 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044965|OTTDARG00000032236|ZDB-GENE-030131-9686 slbp|no_translation DKEY-102M7.2-003 LG_ BX323828.7 Danio rerio protein_coding KNOWN, 645 bp
GCTAAACTGTGCAGGACACCAGCCCTCCAGGACCGAGTTT
CCCCACCCCTGCTTTAAAGTGTAGAGGAGATCGACCTTGG
TGAAATTATGGACTTTGAGTTGGATGTGGAAACGACAGAG
AATACTGAATCCCAATGCTCATCAAGCAATGGAGCAGCAC
AGTCTTTACAAGAGGACGCGTTCATGGAAACACCGAAAAA
GATGATGAAAATTGAGGATTCCGACATGTCTTGAGCAGCT
ACACTGAGTGTCTATGAGAGTATTACTGAGCAGCTGAACT
GTTTTAATGCACTGTTTGTTTTGAGCATCATTGTTTCCAA
CAGGTTCTGATGTTTTTGTGATGACAGGTTTTGACAGCTT
CTTAAAGAGAAGGTTTTGTCATCATCACTGAATTCACCGT
TCTCCACTTTTCTTTTTCGGGTCTTTGGAAGAAAATGTAA
ATGTGTAAATTTTTGGAATTGTTTAATTTTTATTGTGGAA
ATCTGTTTAGTGCTTGGTAAACATTCTCTTGTATTTATCA
ATTTGTTGAATCTCTGATTACAGCAAATATCATATTTTGT
AGTTTGTGATTTTAAATGTTCTTTTAGTTCATTTCTTTTT
TTTTAATTAAAAACCTTTTGAAAATAAATATTAAATTGGA
ATGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations