Transcript

rpl37-203

ID
ZDB-TSCRIPT-091110-245
Name
rpl37-203
Previous Names
  • atp5a1-001
  • rpl37-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043443 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043443|OTTDARG00000020055|ZDB-GENE-040625-39 rpl37|OTTDARP00000034445 rpl37-004 LG_ CR382296.26 Danio rerio protein_coding KNOWN, 756 bp
TCTTTCGAATCAGCTCTGAGGAAAGATGACGAAGGGTACG
TCGTCTTTCGGTAAGCGTCGTAATAAGACGCACACTCTGT
GCCGCCGCTGTGGATCCAAGGCTTATCATCTGCAGAAGTC
CACCTGCGGCAAGTGTGGATACCCTGCCAAGCGCAAGAGA
AAGTACAACTGGAGCGCTAAGGCTAAGAGACGCAGCACCA
CAGGAACCGGCCGCATGAGACACATGAAGGTTGTTTTCCG
CAGGTTCAGAAATGGATTCCGTGAGGGAACTGTTCCCAAA
CCCCGTCGGGCAGCAGTGGCTGCGTCCAGCTCCTCATAAC
GTGTTTCCAATAAAAAGTGACGTTTGAAATGAATCAGCAA
ACTGACCTGCACTGGCTCCAAAGTCACTGTCCAGTCCAGA
CCCTCTAGCCGAGGAGCTGGATGATACCACATAACAGGAG
TTCTCCTGTGGGATGATGCTGGCGGACTCGCACTCCACAT
GGATCTTATCCAGAGACGTGCTCTCCAGCTCCATGGTGCT
GCTTCTACGCAGGGAAGTCATCGGCACTGAGAACTGGAAC
CAGTAAGATCGATTTTCAAGTTACAATGTGAAACACCTGA
GTGATAACACTTCTAAATCAAGCCACATTTCATCAAGAAC
AAATCTCACACTCAAAATCTAAAAATCTTATGCATGTACA
TTTGTGTTGGCCGAAAAGTAGAATTATGTGACTAGTTTAA
ACAGAACTGTTGCAAATATTTACAGTATTTGTGGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations