Transcript

rpl37-002

ID
ZDB-TSCRIPT-090929-7714
Name
rpl37-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024933 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024933|OTTDARG00000020055|ZDB-GENE-040625-39 rpl37|no_translation rpl37-002 LG_ CR382296.26 Danio rerio protein_coding KNOWN, 355 bp
AACCTGGCATTAAAAGCTTACCAGTGATGTGCAAAAATAA
ATGTCTGAACAAATGAGTGTCCAGTGATAACTGATTTTGA
ACTGAGGTAAGCCTGAGGTGTGCCTGAACAGAAGCTGGAC
ATGAGTCTTCTGTCATTCGTTTAAAGTTTAATGATTGGTT
TTGTTTGTAGACAACTGGAGCGCTAAGGCTAAGAGACGCA
GCACCACAGGAACCGGCCGCATGAGACACATGAAGGTTGT
TTTCCGCAGGTTCAGAAATGGATTCCGTGAGGGAACTGTT
CCCAAACCCCGTCGGGCAGCAGTGGCTGCGTCCAGCTCCT
CATAACGTGTTTCCAATAAAAAGTGACGTTTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations