Transcript

rpl37-201

ID
ZDB-TSCRIPT-090929-7713
Name
rpl37-201
Previous Names
  • rpl37-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024932 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024932|OTTDARG00000020055|ZDB-GENE-040625-39 rpl37|OTTDARP00000020535 rpl37-001 LG_ CR382296.26 Danio rerio protein_coding KNOWN, 508 bp
TGGTGTTTTAATGGTACACCAGCGTCTTTTCCGGTCTCTT
TCGAATCAGCTCTGAGGAAAGATGACGAAGGGTACGTCGT
CTTTCGGTAAGCGTCGTAATAAGACGCACACTCTGTGCCG
CCGCTGTGGATCCAAGGCTTATCATCTGCAGAAGTCCACC
TGCGGCAAGTGTGGATACCCTGCCAAGCGCAAGAGAAAGT
ACAACTGGAGCGCTAAGGCTAAGAGACGCAGCACCACAGG
AACCGGCCGCATGAGACACATGAAGGTTGTTTTCCGCAGG
TTCAGAAATGGATTCCGTGAGGGAACTGTTCCCAAACCCC
GTCGGGCAGCAGTGGCTGCGTCCAGCTCCTCATAACGTGT
TTCCAATAAAAAGTGACGTTTGAAATGTCTGTCTGAATAC
CTTAATTTTTTTTATATTAATATTCGGAAAAAAGCTCCTA
GCACTTCACAATGCAAACTAAAGTCTTGATTTGAAAATGG
TTTTATAATAAATCTAGTTTATTAAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations