Transcript

abhd11-002

ID
ZDB-TSCRIPT-091110-234
Name
abhd11-002
Previous Names
  • dkey-269g4.4-001
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043396 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043396|OTTDARG00000021019|ZDB-GENE-040909-1 abhd11|no_translation wbscr21-002 LG_ CR388166.7 Danio rerio protein_coding KNOWN, 469 bp
AACAACATCACGACGACCTTTGAAGTCGCCAACCCCGGTC
GAATGAATGAAGTCCGGACGCACGTTTTAGCATGTCAAAT
TTTGCCATGAGTGCCCTGTGCCGTGTTTTCACAAGAGGAG
CGCCTTGCGGCCTGTCGTCATGTTCATCTGTAACGGGACT
TCGGGATTTTTGCAGCGGAGTCTCGCGGCTGGACCGCGCT
GGCAGTGACAGCATGAGAACCGCCAGTCCATAATAGCGGA
TTTGTTGTCCATTAGCAATCTGCAACTGCTAGATCGCTGA
TAATCATAACAAAAACAATAGCACTGTAGACACAAAACAC
TCATAGCTAGTGATTAATTTGTTTTTCTTATTATTATGTT
TGTGGAAGCATAAAAAGTGGCTTTTATTGACACTTTTAGT
GGATGTAAACAGTATATTGTCTGTTAATAATGATACTAAA
ACTAGGTATTGATCTGTTAATAGTTTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations