Transcript

abhd11-201

ID
ZDB-TSCRIPT-090929-9206
Name
abhd11-201
Previous Names
  • abhd11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026556 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026556|OTTDARG00000021019|ZDB-GENE-040909-1 abhd11|OTTDARP00000021786 wbscr21-001 LG_ CR388166.7 Danio rerio protein_coding KNOWN, 1067 bp
GGCAACCCTGTCGTGCGGGAAGGGTTTCCCTAGTGTTAGC
TAAACAACATCACGACGACCTTTGAAGTCGCCAACCCCGG
TCGAATGAATGAAGTCCGGACGCACGTTTTAGCATGTCAA
ATTTTGCCATGAGTGCCCTGTGCCGTGTTTTCACAAGAGG
AGCGCCTTGCGGCCTGTCGTCATGTTCATCTGTAACGGGA
CTTCGGGATTTTTGCAGCGGAGTCTCGCGGCTGGACCGCG
CTGGCAGTGACAGCATGAGAACCGCCAGCCCTGTAAACCT
GACCTATGATGTGTTTGATGGGAAAGGTGACAGCACGCCA
CTGGTGTTTCTTCATGGCTTGTTTGGGAGCAAATCAAACT
TTCACTCCATTGCCAAGTCTCTGGTTCAACGGACCGGCAG
GAAGGTGCTGACAATCGATGCTCGAAACCACGGCAAAAGC
CCACACAGCCCTGTCTTGACCTACGACACAATGACTAGTG
ATCTGACACATCTGCTGGGACAGCTGCACATTGGGAAGTG
TGTCCTGATTGGACACAGCATGGGCGGAAAGGTTGCAATG
ACTACAGCCTTATCACAGCCTAATTTAGTAGAGCGGTTGG
TTGTTGTGGACATCAGTCCCTCTCTAACTTCAGCCCACAC
CAATTTCCATGCCTACATTCAGGCAATGAAAGAGGTGAAG
ATCCCCAGTGATATTCCTCGTTCCACAGCGCGAAGACTGG
CTGAAGACCAGCTCAGGAAGATAGTTAAGGAGCGTTCAGT
GCGTCAGTTCCTCCTCACTAATCTGGAGGAGCAAAACGGT
CAATATGGCTGGAGAATTAACCTGGAATCCATCTCAAACC
ACCTAGAGGACATCTTGGGTTTCCCTGAATTTGACACCAC
CTATGAGGGCCCTACTCTGTTTTTGGGTGGCAGTAGTTCA
GCCTACATAAGCTCTGACGATTACCCTGAAATCCAGCGGC
TTTTTCCTTGTGCCGATATCCAGTACATCCCAGATGCCAG
TCACTGGATTCACGCTGACAAGCCTTTGGATTTCATCAGC
TCTATAATCACTTTCTTACAGCCATAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations