Community Action Needed: Please respond to the NIH RFI
Transcript

dchs1b-201

ID
ZDB-TSCRIPT-091110-185
Name
dchs1b-201
Previous Names
  • dchs1-002
  • dchs1b-002
  • tiam1-002
  • dkey-22l17.4-002
  • ottdart00000043236
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043236 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043236|OTTDARG00000031095|ZDB-GENE-050208-41 dchs1b|OTTDARP00000034278 DKEY-22L17.4-002 LG_ BX530069.10 Danio rerio protein_coding NOVEL, 2170 bp
GTTGACTATTCGAGCTTCAGATTCCAAGCACCAGAGTGAA
GCCAATTTGACCGTGGTGGTGGAGGATGTAAATGATAACG
TACCTACTTTTACACAAGATCTATATCAGGTAACACTTCC
AGAACATTCTCCACCAGGCAGTCCTGTTATCACAGCACAG
CTCTGCAGAAGTTGGATGAATCTAAACCCTCAGGGAGTGA
CAGGATCTATCATCAGGCCCTTCCTGGATATGCAGGGGAT
GAGGAAGGAACAGGTGCAGGCTCTTACACTCGAGGAGGAT
CCCTAGATCCTTCTCACTCCAGTGGACGGGGATCTGCCGA
AGCAGCAGAGGATGATGAAATTCGGATGATCAATGAGTAC
CCAAGAGTGGCAAGCATCACATCCTCCATGCAAGAGCACA
TTTCTGCCAGGGGCCCTGATTCAGGAATCCAGCAAGATGC
AGACCAGCTCTCTGATATTTCTTGTGAACCAGGTCCACTT
GATGCAAGCCAGTGGTTCAAAAGTAAGAAACTGGGGAGCA
TTAGTGGAAGCCTCAGTGGTACCCTGCTTTCTGGTCAGCT
CCCAGTCTACAGAGATGAAGGCGGCGGCTATCTTGGAGTA
GGTCGTGGGTTGAATATTTCCCATCCGAAAGATTATGCTT
TCCCTGAGGATGGCAAACCCCCGGTTGACGGTTCTCTCAC
GGCCATAGTAGCAAGTGATGAGGAATTGCGAGGTAGCTAC
AACTGGGACTATCTTCTCAACTGGTGCCCTCAGTTCCAAC
CCTTAGCCAGTGTCTTTACGGAGATTGCCAGGCTAAAAGA
CGAAAGTTTACCTCCTAACAACCCACGGAGACCTTTCCAA
CCCAAAATCAAGACAGATCCCAAGCCTAGGATTGACCCTC
CACCTCTCATTACCTCAGTGGCTCATCCGGGGGCCAAATC
TGTTCCACCCAAACCTGCCATAACACGGACGTTCCACACC
TTAGCATCCCTAAGGCGCTCACCTATAAGCCATGAAGGCT
CCATCTCCTCAGCAGCCATGTCTCCCAGTTTCTCCCCTTC
TTTGTCCCCACTTGCTGCACGGTCCCCAGCTGTTTCTCCA
TTCGGTGTCACTCAAGGTCCCTCAGCCTCCATCATCAGCA
CCACAGAACACACTCTGGAGCACACTGATGAGGCTGAGAT
GAGGATTTAATGCTGCATTTAACTCCATTCCGTGGAGGCC
TTATTTTGTCTTTTGATAAGACGTATTAGTCACTCTCAGC
AATGTTTAACGCTTAAAAATGCAGCATGAAGAATCAGTCT
CAGCCATGACGGTGACGCAGGTGTCTGTTAACGGAAAGGG
TGCAAACATTGTGCGGCCACGTTACCCTTCTTCAGAGCCA
CCGCAGTGTTGATGTGAAGAGTTGTTTGCGCATTGCTTTG
TTTTGTCTCACTGGCTGGCCAGGGAGTCAAGATGCTGACT
GCTCTTTTTGTTTGTTTCTTTTTATACTGATGACTCAAAC
AGCTTTGAAACTCCAGTGTTATGTTAAGTTCATCCAAAAT
AGCTGCTATTGTCATACCTTGTAGACCGCAATGAGAACTC
TGTAGAAACTCAAACTTATGTCATTACGTATGTTTGTTTA
TGACTGAGAGACGTTTTATTTTTTACCCCCCTTTTTTGTT
TTTACAGTGCTACTTTGTTTCATTTGCATTTTTTATGAAA
GACTTGCCATTGGTTTGAGTGAAGTTCTTACATTTTAGTG
GCATTCTTCATATGTATATTTATATATGTACGCTAGCCAT
AAGTGTATTATCATTGTATAGTGTCTAGGATCACCATACT
GTGCGGTTGTGAAATTTGTGACACTTGTAATGTGAATGAT
TGGAAGATTGTTGTATTTTATTATTTATAAAGAGAAAGGC
TGAAAGCATTGAAACTCCCCATGTTACATAGTGTTGTATT
ATAGGTCTTTTGAAGTTGTATTGTTCCTTGCCCTTTAAAC
TAGATGGTTAGCACCTTAGCTAATTTATTGTTTATTGAAA
AAAATGACAGGGCCACACTCTTTCGGCCCATCTGGAGACC
TTTTTGGATATTGGTGAAACCTCAAAGACTCTTCTGTATG
TAAATTAATTTCTTCCAAAACAGCAGCTCTCTCACACTGT
TTCTATGCTGCTTTTTTCTGACAATAAAATGTTTTGTATT
GTCTATGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations