Transcript

dchs1b-203

ID
ZDB-TSCRIPT-091110-1641
Name
dchs1b-203
Previous Names
  • dchs1-001
  • dchs1b-001
  • ch211-250c16.2-001
  • dkey-22l17.4-001
  • ottdart00000043235
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043235 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043235|OTTDARG00000031095|ZDB-GENE-050208-41 dchs1b|OTTDARP00000034277 DKEY-22L17.4-001 LG_ BX530069.10 Danio rerio protein_coding NOVEL, 4224 bp
AACACTTCCAGAACATTCTCCACCAGGCAGTCCTGTTATC
ACAGTAACAGCAACAGATCGAGATTCGGGAGAAAATGGAA
AGGTCTCTTATCGAGTGTTGTCTTCAACGCGGGATGGGTT
TTACGTTGACCCTAAAAATGGTACACTTTTCATCAGGCAG
AAAGCAAAATTTGACCCAGAGGAGCCCTCTGTCAGTATAG
TCATCGAAGCTCGTGATGGAGGGTCTCCACCTCTGTCATC
ATCTGCCACAGTTCAAGTTCAACTGATGGACGTCAATGAC
AACGCCCCCATATTCCACCAGTTGGAGTACAAAGCCACAG
TGTCTGAGGACCAGCTACCTGGAGCCACCATCCTTACCTT
AGAAGCAGTAGATGGAGACCTGTCTCAGGAAAACTCTGGT
TTTGATTTTGCAATTGCCAGTGGGAATGTTGGAAATGCTT
TCCAGATTGAGAGCAGTGTTCGTTTCATTGAAGGTCATGG
CTTCCAGACTGTAGGAACCCTGATCTTGGCTGAGCGACTG
GATTTTGAAGCATTGTCACACTATAACCTCACCGTTTCAG
TTTCGGATCGTGGTGTTCCCCAACGGAGCTCCAGTGTACC
AGCCATCATCACAGTCACTGATGTGAATGACAACCCTCCT
GTTTTTGGCAGAGCTGAATACATAGTGGCTTTGAGTGAAG
GGGCAGCTGCTGGTGCAGAAATCTTACGTGTGACTGCAAC
GGATCCTGATTCAGCTCCCTACGCAGAGGTCCAGTACAGC
ATCAGCTCTGGAGATGATATGAAGCTGTTCTCTGTGGATC
AGTGGACTGGTGCTATGAAGCTCCAAAGGCCTTTAGACAG
AGAGAGCCAAAATTCCCATGTAGTAATAGTACAAGCATCA
GATGGCCATGGTCGATTTGCTTTGGCACCTATTAGTGTTG
AGGTAAAGGACATCAATGATAACAGACCTTACTTTCCGAT
TGCTACATTAACAGCCAGCATTCGTGAAAACCAGCCTCTT
AACTCTGCTGTAACCGTGTTACATGCCATTGATTATGACA
CAGGAGTTTATGGGCAACTGAAGTATTATTTGATGGACCA
CTCCAGCCCTGGGAAAGACCTCTTTTTTGTAGATCAGAAC
TCAGGAGAAGTTCGTACCAAGCAGATATTTGATTTTGAGA
AGGTGAACTCGTTCAACTTCATTGCTTTGGCTGTGGATGC
AGGCAACAACTCAGCTACTGTCACAGTGCAGGTCTTCATT
ACAGGAGAAGATGAGTATGACCCAGTTTTTACCACTTCAG
ATTTGTCTTTTGAAGTTCCTGAGGGAGCCAAGAAAGGTCA
GAGCATTGGGCTAGTACAGGCCAAAGATGAGGATGGTGGG
GTGGATGGGATTGTACTCTACTCCTTCCCCAATTCCTCTC
CATACTTTGATGTTAATAAGACCACTGGCGTTATCTACCT
AAAGATGGACAACTCTGGCAGTTCAAGTGGTGGTAGTCGT
TCAAAGAGGGAAACCCGCCTAATGACTATGGATGTTTCTG
CCCACAGCCCGCTTGACACCTCAAGAGTAGCTTCTGCTCA
GGTCATCATCGATGTCACGAACACATCCTTTGGTCTTGCA
ACAGACTTTAACATTCTCCTTGTCAGCATAATTGCTGCCT
CTCTTGGTGTAATAGTCTTGTTAGTCATAATAGCTGTTGC
TCTCTATTTAGTAAGATCAAAGCGCAAGAAGAAAGGACAA
GATGCTGGAAACAGTACTGCATCTTCAGGCACAGCTCTGC
AGAAGTTGGATGAATCTAAACCCTCAGGGAGTGACAGGAT
CTATCATCAGGCCCTTCCTGGATATGCAGGGGATGAGGAA
GGAACAGGTGCAGGCTCTTACACTCGAGGAGGATCCCTAG
ATCCTTCTCACTCCAGTGGACGGGGATCTGCCGAAGCAGC
AGAGGATGATGAAATTCGGATGATCAATGAGTACCCAAGA
GTGGCAAGCATCACATCCTCCATGCAAGAGCACATTTCTG
CCAGGGGCCCTGATTCAGGAATCCAGCAAGATGCAGACCA
GCTCTCTGATATTTCTTGTGAACCAGGTCCACTTGATGCA
AGCCAGTGGTTCAAAAGTAAGAAACTGGGGAGCATTAGTG
GAAGCCTCAGTGGTACCCTGCTTTCTGGTCAGCTCCCAGT
CTACAGAGATGAAGGCGGCGGCTATCTTGGAGTAGGTCGT
GGGTTGAATATTTCCCATCCGAAAGATTATGCTTTCCCTG
AGGATGGCAAACCCCCGGTTGACGGTTCTCTCACGGCCAT
AGTAGCAAGTGATGAGGAATTGCGAGGTAGCTACAACTGG
GACTATCTTCTCAACTGGTGCCCTCAGTTCCAACCCTTAG
CCAGTGTCTTTACGGAGATTGCCAGGCTAAAAGACGAAAG
TTTACCTCCTAACAACCCACGGAGACCTTTCCAACCCAAA
ATCAAGACAGATCCCAAGCCTAGGATTGACCCTCCACCTC
TCATTACCTCAGTGGCTCATCCGGGGGCCAAATCTGTTCC
ACCCAAACCTGCCATAACACGGACGTTCCACACCTTAGCA
TCCCTAAGGCGCTCACCTATAAGCCATGAAGGCTCCATCT
CCTCAGCAGCCATGTCTCCCAGTTTCTCCCCTTCTTTGTC
CCCACTTGCTGCACGGTCCCCAGCTGTTTCTCCATTCGGT
GTCACTCAAGGTCCCTCAGCCTCCATCATCAGCACCACAG
AACACACTCTGGAGCACACTGATGAGGCTGAGATGAGGAT
TTAATGCTGCATTTAACTCCATTCCGTGGAGGCCTTATTT
TGTCTTTTGATAAGACGTATTAGTCACTCTCAGCAATGTT
TAACGCTTAAAAATGCAGCATGAAGAATCAGTCTCAGCCA
TGACGGTGACGCAGGTGTCTGTTAACGGAAAGGGTGCAAA
CATTGTGCGGCCACGTTACCCTTCTTCAGAGCCACCGCAG
TGTTGATGTGAAGAGTTGTTTGCGCATTGCTTTGTTTTGT
CTCACTGGCTGGCCAGGGAGTCAAGATGCTGACTGCTCTT
TTTGTTTGTTTCTTTTTATACTGATGACTCAAACAGCTTT
GAAACTCCAGTGTTATGTTAAGTTCATCCAAAATAGCTGC
TATTGTCATACCTTGTAGACCGCAATGAGAACTCTGTAGA
AACTCAAACTTATGTCATTACGTATGTTTGTTTATGACTG
AGAGACGTTTTATTTTTTACCCCCCTTTTTTGTTTTTACA
GTGCTACTTTGTTTCATTTGCATTTTTTATGAAAGACTTG
CCATTGGTTTGAGTGAAGTTCTTACATTTTAGTGGCATTC
TTCATATGTATATTTATATATGTACGCTAGCCATAAGTGT
ATTATCATTGTATAGTGTCTAGGATCACCATACTGTGCGG
TTGTGAAATTTGTGACACTTGTAATGTGAATGATTGGAAG
ATTGTTGTATTTTATTATTTATAAAGAGAAAGGCTGAAAG
CATTGAAACTCCCCATGTTACATAGTGTTGTATTATAGGT
CTTTTGAAGTTGTATTGTTCCTTGCCCTTTAAACTAGATG
GTTAGCACCTTAGCTAATTTATTGTTTATTGAAAAAAATG
ACAGGGCCACACTCTTTCGGCCCATCTGGAGACCTTTTTG
GATATTGGTGAAACCTCAAAGACTCTTCTGTATGTAAATT
AATTTCTTCCAAAACAGCAGCTCTCTCACACTGTTTCTAT
GCTGCTTTTTTCTGACAATAAAATGTTTTGTATTGTCTAT
GTAACTTACGATTGGTTCATTTTAAATTAAGAAAAAAAAA
AATCCTCATTATCCGGAATGGTGTTTATTTGCCTTTCAGG
GTGAATCACAGAAATTGTACCCTCTTTTGTAAAATCTGGT
GGACAATTTCTGCTTTAAGAGGAAGTGCCCTGCTTTTTTA
TCTCGCAATCTTATGTGTAAAAAGCTAATTAAGCATTTGA
ATGAATTTCCGGAGATGTTTTGCTACCTCCGGTGCGTGCC
TGATACCGCCACTGCCTCAGGTTTAACAGGCCCCTGCTAG
CACCCACAACAAATGCAAAGGAAAAGAAGAGCCTGGCATA
TTTAGAAGTCTGTTTAACCCAATTCTTTTTAGAAGGTGAC
ATTTATTTGTCTCACAGTCTGGAAAACAACCTGAAATTCC
GACAGCAGAAGAGCGTCAATCATCTGTGCATATTTAAATC
AAATAATAAATTTCTTTTGTCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations