Transcript

gad2-002

ID
ZDB-TSCRIPT-090929-9676
Name
gad2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027094 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027094|OTTDARG00000021333|ZDB-GENE-030909-9 gad2|no_translation gad2-002 LG_none CR855137.7,BX530066.21 Danio rerio protein_coding KNOWN, 511 bp
ATTGCGCACGGCGCACCAGCTGAATATAGACACTCTGTGC
TTTGCCTGAGAGCTTAGAGCGTGTTTTATGAGCTCTTTAG
CAATTAAGTCACTTGATTTGACGCGTTTGGACAGGTGTGA
TTGTACACGCATTGGATTTCCAGCGCATCGGACAAGATTC
AGCACCACGGCTGCGGACAGCTCCCGTTCCCCGGTGACGC
GCGTCTGGATGGCTTCTGCTCGCGTGTCTCTGTCGCTGCT
CTGATCCGCTCCGCTCGCGATGGCATCACACGGGTTTTGG
TTTCTGGGGGCTGAAAACGCGGCTGGAAACGGCAGTCAAA
GCCCGAACACGCCTAGAGCATGGTGCCAGGCGGCGGCCCA
GAAATTCAGCGGAGGCATCGGCTCCAAATTATGTGGTACG
TTTATTTTTAACATGCCATTTAAAAATCTTTGCCTCTCAC
CAACATTCTTAAAAATGTAACATCATTATGAGCAGCGCCA
GATTTGATCAGCAACCATATGCAACTTTAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations