Transcript

gad2-201

ID
ZDB-TSCRIPT-090929-9674
Name
gad2-201
Previous Names
  • gad2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027090 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027090|OTTDARG00000021333|ZDB-GENE-030909-9 gad2|OTTDARP00000022204 gad2-001 LG_none CR855137.7,BX530066.21 Danio rerio protein_coding KNOWN, 6409 bp
ATCAGTGCCAGTGTTTCTCCATGAGTTCAGTGACGGTCTC
CGGCTGCTCCAAATCATTGCGCACGGCGCACCAGCTGAAT
ATAGACACTCTGTGCTTTGCCTGAGAGCTTAGAGCGTGTT
TTATGAGCTCTTTAGCAATTAAGTCACTTGATTTGACGCG
TTTGGACAGGTGTGATTGTACACGCATTGGATTTCCAGCG
CATCGGACAAGATTCAGCACCACGGCTGCGGACAGCTCCC
GTTCCCCGGTGACGCGCGTCTGGATGGCTTCTGCTCGCGT
GTCTCTGTCGCTGCTCTGATCCGCTCCGCTCGCGATGGCA
TCACACGGGTTTTGGTTTCTGGGGGCTGAAAACGCGGCTG
GAAACGGCAGTCAAAGCCCGAACACGCCTAGAGCATGGTG
CCAGGCGGCGGCCCAGAAATTCAGCGGAGGCATCGGCTCC
AAATTATGTGCTCTGTTAAATGTCGGGGAGGCTGAGAAAG
CAGCTCAAGCCCCAGTTAAAGCCGAGGATGAGTCTACAGC
CGAGAGCTGCGGCTGTAATAAACCCTGTAACTGCTCCAAA
GCCACCGCGTGCTTTTCGGATCTCTACTCAACAGATCTGT
TACCTGCACTGGACGGAGACGCGAAGACTATGAATTTTCT
GCAGGAGGTTGTGGATATATTGCTGGCTTATATAGTGGAA
TCATTTGACAGGTCTACGAAAGTGATTGATTTCCACTATC
CAAACGAACTGCTCCAAAGGAATAATTGGGAGCTTTCGGA
CGAACCCGAGACTTTAGACGATATTCTGATCAGCTGTCGC
GCTACGCTTAAATATGCCATAAAAACTGCGCATCCCAGGT
ATTTCAATCAACTCTCCACTGGGTTAGACATGGTTGGCTT
GGCTGCAGATTGGCTAACCTCCACTGCCAACACCAATATG
TTCACCTATGAGGTGGCTCCAGTCTTCGTGCTGTTGGAAT
ACGTCACGCTGAAGAAGATGAGGGAGATCATTGGCTGGCA
GGACGGCCACGGTGATGGAATATTCTCTCCGGGTGGCGCC
ATTTCCAACATGTATGCCATGCTACTGGCTCGCTATAAAA
TGTTCCCTGAGGTGAAGGAGAAAGGAATGTCATCCGTACC
TAGGCTGGTGGCCTTCACATCAGAACATAGCCATTTTTCA
ATCAAGAAAGGAGCAGCTGCTCTTGGAATCGGTACAGAGA
GTGTCATTTGCATTAAAGCTGATGAGAGGGGTAAGATGAT
TCCATCTGACCTTGAGAGGAGGATCATTGAAGCCAAGCAG
AAGGGATACGTGCCGTTCTTTGTCAGCGCGACGGCCGGCA
CCACGGTTTATGGTGCCTTTGATCCTTTGATCGCTATAGC
GGACATCTGCAAGAAGCATGACGTCTGGATGCATGTGGAT
GGAGCATGGGGTGGAAGTCTGCTAATGTCCCGGAAACACC
GGTGGAAGCTTAATGGAGTTGAGAGGGCTAATTCTATGAC
CTGGAACCCTCATAAAATGATGGCTGTGCCCTTGCAGTGC
TCTGCTCTTCTGGTTCGAGAGGAGGGACTGATGCAGAGCT
GCAATCAGATGCAGGCCTGTTATCTGTTCCAGCAGGACAA
GCATTATGACCTGCAGTATGACACAGGAGACAAGGCCCTG
CAGTGTGGACGTCATGTGGACATCTTTAAACTGTGGCTGA
TGTGGAGAGCTAAGGGCACGATTGGTTTTGAGGCTCAGAT
CGACAAATGCCTGGAGCTTTCCGAATATCTCTACAACAAG
ATTAAGGACAGGGAAGGATATCAGATGGTGTTTGATGGAA
AGCCGCAGCATACCAATGTGTGTTTCTGGTACCTTCCACC
GGGCGTGCGCTACCTGGAGGACAAAGTGGAGAGGATGAAG
CGTCTGCACAAGGTTGCCCCTGTAATCAAAGCCAGAATGA
TGGAGTACGGCACGACCATGGTGAGCTACCAGCCACAGGG
AGACAAGGTCAACTTCTTCCGCATGGTCATCTCCAATCCA
GCCGCTACCTTTGAAGACATTGACTTCCTCATTGAAGAGA
TCGAGCGACTGGGGCAGGATCTTTAAAACTTACCGCACCA
AAACCTGTTACTCCCGTGTCCCTGGATGGATTGCATATTT
GTTGTGAATGTAACGGTAAATCTCTGATTCCTCTTCTCCA
AAGTCACATTTAAACAAAAAAAGGATAATATGAAAATATC
TAGAGTATAGTATTGTAGCGTCGTTGTGGGCTTCATGGTC
CAGAGCCCTGTAAAAGTGTTACCGTCTGCTTTTACTGTCT
ATCTTAATGTCTTTGACATGACTTTGTTTGTTTACATGTT
TATTGAGAATATGAAGAGTTGTTTGCTTCTATTCGGTGCA
GATCATATGTTTCCATTTGAACAGTTATTCAAGGTGCCAG
ATTACATTGATATGTATACGTGACTATAGTATGATAGTAG
AGACATATTAATCCAAAAGCACTTCATCATTTCTATCAAG
ATTTACAATTATTCGTTTTTAAAATAGTTTTTAACTATTA
TTTTACCAAATACTCAAAAATCAGCCATTTTTATTTGAAA
AAGTGTCAAAAAAAGAGATAAAATTGGGTGCTTTATATAG
TTTTACACTTCTAAAAGCTGATTAAAATTAACATTAAACA
TACAGTTGAAGTCAGATTTATTAACCCCCCCCCCCCTGAA
TTATTAGACCGCTTGTTTATTTTTTCCTTAATTTCTGTTT
AACGGAGAGATGTTTTCAACAAATGTCTAAAGATAAGAAT
TTTAATAACTTATTTCTAATAACTGATTTATTTTTATCTT
TGCCATGATGACAGTAAATAATATTTTACTTGATATTTTT
CAAGACTATATACAGCTTAAAGTGACATTTAAAAGCTTCA
CTGGGTTATTTTGGTTAACTAGGCAGGTTAGGGTAATTAG
GCAAGTTATTGTATGATGATGGTTTGTTCTGTAGACTATC
GGGAAAAAAAATAGGTTAAAGGTTCTAATAATTTTGTCCC
TAAAATGGTGTTTTAAAAATTAAAAACTGGTTTTATTCTA
GCCAAAATAAAACCAATAAGACTTTCTCCAGAAGAAAAAA
TATTATCAGACATACTGTAAAAATGTCCTTGCTCTGTTAA
ACATCATTTGGAAAATATTTTTAAAAAGAAGAAAAAATTC
AAAGGGGGGTTAATAATTCAGACTTCAACTGTATTTAGAA
ATGTAAATATTAACTTGTATCTTCTAATAAACACATCCCA
AAATATTTATCCTGATCACAATATAAGAATTACCTGTCCA
CCTTAAAATATGTGCAATCATCAACAATATTCAATGTTCT
TTTGCCTTGAAATGTGTAATTTCCAATTGAGTAAAGTGCA
ATAGTGGTTAAGTAAAGTAAAATGAGAATAAATATAATAT
TAATTCTTTAAACAATAGCATATGCACATCATATACAGTA
TTTAAAAAAATAAAAAAATAAATAAAATGACAAATTTAAT
ATAAATACCTTCGCTTCCCTACATTACACAATAGCATTAG
ATTTCTTAATTTACCAACCCATCCATGCACTTGTTTAGCT
TTCCTATACATAATGATAAATATTTCAGGGTATTAACAGA
GCTAAATTTAATGTCATATATATATAAACTCCAAAAAGAA
AAGAACGCATAAGCATACGTGGGGTTATGCCCTATGATAG
TGTGTAAATAGTCTTTTAAGATGTTCTTGATCGAGTACAT
ATCTATGTGAATACATCACTGTATTGTATATACGCAGAGT
CTATTTGTGTGGTAAATAACATTATTTTCTCTATTCAAGA
AATATTTAATCCTAAATGGTAGATGCGTTCTGCTTGTGTG
TGCGTGCGTGCGTGCGTGTGTGCGTGTTGAATATGATGAT
TTATGTAACTGCAAAGATATGTGTATGGAGGATCCAGTGC
ATTTTAACACACTTACTCGAAATGATTATTATTATAGCAC
ATTTGGAGAGCCATTTCTGAACCGATGCTGGTTGTATTCG
TGCCCAAGTGGTTAACTTGACATCCTGTGCCGATTTGTAT
TTTCGTGTGTTTGTAACTGTATTGCCTTAGTATTAATTGC
CAGTATTGTCTAGTTCTCCTAAAGAGGAGCTTGTGCACTT
TAGCTTATATGTATGATGATCTGTCCAATGGATGTTCTTA
GTTTGATGTTTTAAGAAACTTAGCGTTGTCTGAATGTGTC
CAAGGCTTGGTCATCCGTTTGGGATGAGAGTTGCTTTATT
GCTAAAATCATTTGTAGATTTAATGCTATGTTTCTACCTG
CTGGAAAAGCACAACTGAAAGTTGCACTCCAAAAAATGAT
GTCGTCACCCAATATTTTTGTTGTTTTTCCAGTACACATA
TCGACATTTTAAAAGCAAGAAGCATCTACTTTAGAATGAC
TTGAGATAATGAGTCTAGTGGTCTTGAAATATCATTTTAA
ATTAGCTAAATTTGCTTTGTAAACAAAAACATGTGTGCCA
AAGGGGTCAGAAAAATGTAAATAGAAAGAAAAGAAAGATT
ATTTTTCTCACCTCATTGGCAATCAAAAATAAATTACATT
TTGAGACATGTTTTGGTAAACAAGACTAGTAAACAATTGA
CTTGAATACTCTCCTGTGAAAGCAGCCTACTGATGGGAGT
GTGCTTTTGATTCTCATGATGGAAAACGTTTTAAGAATTT
TGGTTGTCATTTATATCAGTGGTCCCCAACATTTTTATCA
CAGTGGATCAGTCAACGACGATTTTACCGCGGCCTGGGTG
GGGAGAATCGGGGGTTGACGTATGATGGGGGGCTTGGAGG
TTGGGTGTACGTACAGTAGATTGCTAGGTGACCATCAACC
GTTTTCTCAGGGAATGACGGGCTGACAAAACATTGCTGCA
ACTCTGATACAAGTTTTATTTATGGAGAAAATTAAAAAGC
ACTGGAGTGTTTGGCTATTAAGTGTTTAGCCTCCTGAAAT
GTGTATATTCCATACAAAGTATGAAGCTAATTAAATAATT
CTTGTCACGTGACTTGCGTTATTCTGAAAAACTGAGATGT
TTTCAACTAGGTGAGCCTGGAAGACACGAGCGCATCGCTT
CCAATTCGTGCGCACATGCGGAATTGCAGTATGAGAAAAT
TGTACTAAAATGTACAGATGAGATTGTACAAACTCATATG
AATTAGCCACTAAATCAAACATGAATTTCTATGGGCTTGT
TTTGGAATCACCAACAAATAAACCATATATGAAGCTAGGT
GTTTCCTCGCTTCATCATCAAGTTTTCTGCAGTGCATCTT
TTAAAAATGCCAAGCTACCAGTTAGTAAATCTGACCCTTA
ATATGTTACCTTGTCTGTTTCTTAAGTAAATGTTTCCTTA
TTTAAGAATATATAGAAATGTATACTGGAAAACAAGACGA
AAGTACTGAGCACATCATTTTTTTGCAGTGAGCTAATATG
GTTCTAGCTAGCAACAAGCTAACCTAACAAGCTATCTTCT
TTTTCAGCATGGAAGGAATGCTAAGTTTGTAGTTTTTTGA
GATACCAGTGTTTTTTTTCTGTCTCTTTTCAGGATCGACA
AGCTGTGTCACATAGTTTGTGTAATTTTATGCTCTTGTAA
TCATGACAAACGCATCGACATCCTCACTGTGGTAGTCTTG
GAACGCCTTTGTGCCGTCTTTCCCCGCTGCTGCTGCTACA
AACCTGCTCTCTTTGCACGTGCATGAACGCCTTGCCTTCC
GAGCTTGTGAAATACAATCCCAAATATTCATATATATCTA
TCTATCTATATATAGTGGAACCTGGTGTTAGTTTTAGTGG
CAATATGGATAGCTTAGCTTCAAATATATAGTACTCTGTC
GCTAGCTTGCTCACTCTGTGTTAGCATTACCCAACGTATT
TATCTGCTAAGCAAGCATGTTCTATGTGGCTAGAAATTGT
AAGCTTTCGCGACCGTATCTCTATCTTTCTCTCTGTCTTT
CGCTCGTTCTTCCGCAGCTTTACTATTAGCGTGTGTAGTT
CCTTGGCATGCCTCTATATAAGCATATTTAACGTCTGGAT
GTCTCTCTATCGCACTTTTTCTTCTTCCTGCGTCTCTCTT
TCTCTTGCTTTGCACTGTAGCAGCTCTCAGGCCTTTAAGA
GCAGTGTTCTTCCTGCTGGTTCCCGGCTACCCATCATGTC
CATCGGTTTGTCGTATGAGGAACGTCATGAACCTGACCAA
ACAGGGTAACACCATGGTGAATTCATTTCTGTTTTCTTTC
CTTCTCACTAAACATTGCTTGAAAGGAAAGTGATCATTTG
AGAAACTGTCGTTCAGATGAAAGTTATAAACGCTAGCGTG
TTGAAATTCTATAGCAAGAGGCAGGTAACAGACCCTCTTG
AATTGTGTTTTACTTTCATTGGAAACACCAATAAATGTTA
CTGCCAATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations