Transcript

tmem50a-204

ID
ZDB-TSCRIPT-090929-9112
Name
tmem50a-204
Previous Names
  • tmem50a-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026437 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026437|OTTDARG00000020952|ZDB-GENE-040426-2937 tmem50a|OTTDARP00000021687 tmem50a-003 LG_ BX465191.6 Danio rerio protein_coding KNOWN, 582 bp
TGCGGAGTGAATCTCCAGTTACTGCGAAGCACTAGAAAAA
AACTCAAGGAAAGTACAGGTCAGATCAGCAGAATGTCGGG
ATTTCTGGACGGGATCAGATGTGGCGATTGCGAGTGTAAT
GTGGACTGGGGCGAGAAGAGAAACACCATCGCCTCCATCG
CAGCTGGAGTTTTGTTTTTTACAGGCTGGTGGATCATCAT
CGACGCAGCGATAATGTATCCTAAAGAGGAACAGTTCCAC
CATGCGTATCATACCTGTGGCGTTATAGCCACTATAGCCT
TCCTCATGATCAATGCAGTGTCAAATGGCCAGGTGAGAGG
GGACAGCTACAGCGAGGGCTGCTTGGGACAAACAGGTGCT
AGAATTTGGCTCTTTATCGGGTTCATGTTGGCATTCGGGT
CTCTCATCGCCTCTATGTGGATTCTGTTTGGTGGTTTTGT
TGTGACTGGAACAGAACATAAGGATCTGTCTGTGTATCCT
GGTATTGCAGTTTTCTTTCAAAATGCATTCATCTTCTTTG
GGTAAGTTTATAAAAATATCAAAAGCCCTCTTTTCGTTTA
CCTCTGTATTTTATCTAAGCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations