Transcript

tmem50a-203

ID
ZDB-TSCRIPT-090929-9110
Name
tmem50a-203
Previous Names
  • tmem50a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026435 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026435|OTTDARG00000020952|ZDB-GENE-040426-2937 tmem50a|OTTDARP00000021686 tmem50a-001 LG_ BX465191.6 Danio rerio protein_coding KNOWN, 1687 bp
GCAGGGCGCACTGCGCATGCGCGGCTCAGATCCACTGTAG
GAGACGGAAGACTGCGGAGTGAATCTCCAGTTACTGCGAA
GCACTAGAAAAAAACTCAAGGAAAGTACAGGTCAGATCAG
CAGAATGTCGGGATTTCTGGACGGGATCAGATGTGGCGAT
TGCGAGTGTAATGTGGACTGGGGCGAGAAGAGAAACACCA
TCGCCTCCATCGCAGCTGGAGTTTTGTTTTTTACAGGCTG
GTGGATCATCATCGACGCAGCGATAATGTATCCTAAAGAG
GAACAGTTCCACCATGCGTATCATACCTGTGGCGTTATAG
CCACTATAGCCTTCCTCATGATCAATGCAGTGTCAAATGG
CCAGGTGAGAGGGGACAGCTACAGCGAGGGCTGCTTGGGA
CAAACAGGTGCTAGAATTTGGCTCTTTATCGGGTTCATGT
TGGCATTCGGGTCTCTCATCGCCTCTATGTGGATTCTGTT
TGGTGGTTTTGTTGTGACTGGAACAGAACATAAGGATCTG
TCTGTGTATCCTGGTATTGCAGTTTTCTTTCAAAATGCAT
TCATCTTCTTTGGTGGTCTGGTGTTCAAGTTTGGCCGAAC
TGAAGACCTCTGGCAGTGAGGATCCATGTCCATCAATCAA
ATCCCACAGTCCATCAACACACAGTTCCTCTCTACTTACT
GCTGCTTATTTGCACTCTCTATTTCTTTCTCTCCTCTTTT
TCAATGACGACTCCTCTTAAATATTCTCCTTTCTTCGTCT
CCGTGTGGTCACAGTAGGTGAGAGAAATGCAAATCAAACC
AGTTGAAATGGACACTATCCTGCCCTTATTATACACATAC
TTCATAATATAGCGCACCATAGAGGATATCTTCAGCCTGG
CTGTTTCAAAATCACAAAAATATGGACAGCATAATGATAT
ATTTACATGATTATTACGCTACAGGGCGGTGGGAGAGTTT
CTGAACAGATTCTTTATTAACCAAAACAAGCATTGCTGGC
TTTCGGCTTCACTGTGTTTCTTTTTTTATTGCGCGTTGGT
CATTTGAATAAACATAAACCACCCGATTTGTATATTTTGA
AACACTTTAATGTATGACGACGTTTAATTTCACGTTCTGT
CAGAATTTGTGTTGATTTTGCTGTCGTATTAACCGAACGG
CTCAACTGACTTCAATCGCGACACTACAGCGTACTTTTGG
ACGATTTTATGTTATGTTATATGGGTTCACACAGCTTTCT
CAGACATTTGTCATGATTGATTTTTAACAATTATTTTACA
GAGAGCATCTTTGAGCTGATCTACATTCACTGTCGACATT
TAAAACGTTTTTTTTTTTTTCCTCAGAGTTTGCAACAGAA
CCAAACAGAAAGAGTTTTGCTTGACTGTGTGAACGAACCC
TTGTTATATATTTGTGTTCTGAAGCTTTAAGTTGACTCTC
TCTATGTTCGGGCATGTGGGAGTTGTATAAAAGATGTTTT
TTAAAAGCACAATTTCTTATTATTTCTTATTTCAGTAGTT
TATGGAAGATTGATAATTCGACTTGTCTGTTAAACTAACA
AATTAGGGGATTTCTACATGCTAAAAGAATGTAACATTTT
AATGTAATCCACTTTTTCTGACTAAAAAAAAGTAGCTAAA
ATTCATCAACTGTGGGTTTAAAATGAAATAAAATTATTGT
AAATATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations