Transcript

tmem50a-002

ID
ZDB-TSCRIPT-090929-9111
Name
tmem50a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026436 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026436|OTTDARG00000020952|ZDB-GENE-040426-2937 tmem50a|no_translation tmem50a-002 LG_ BX465191.6 Danio rerio protein_coding KNOWN, 923 bp
CACATTTGTAAAGTGCTGGAAAATGAAAAGGCGTGAGAAT
GCTGAGAGAACAAGTGCTTGTATTCGTTGTGTCCATTCAG
TCTAACTGTCTGACATAAGTTGATCTGGCCTAGATCTTTC
TTCCTGTTCTTCATCTGTGATTTGCCTTCAGAGTTGTTCA
TTGACTACTTCACCATGACTACTTTGTTTAACCATCTGTT
GAGTTTCACTTTCTGTGGATTTGCGTGCAGGATCAATGCA
GTGTCAAATGGCCAGGTGAGAGGGGACAGCTACAGCGAGG
GCTGCTTGGGACAAACAGGTGCTAGAATTTGGCTCTTTAT
CGGGTTCATGTTGGCATTCGGGTCTCTCATCGCCTCTATG
TGGATTCTGTTTGGTGGTTTTGTTGTGACTGGAACAGAAC
ATAAGGATCTGTCTGTGTATCCTGGTATTGCAGTTTTCTT
TCAAAATGCATTCATCTTCTTTGGTGGTCTGGTGTTCAAG
TTTGGCCGAACTGAAGACCTCTGGCAGTGAGGATCCATGT
CCATCAATCAAATCCCACAGTCCATCAACACACAGTTCCT
CTCTACTTACTGCTGCTTATTTGCACTCTCTATTTCTTTC
TCTCCTCTTTTTCAATGACGACTCCTCTTAAATATTCTCC
TTTCTTCGTCTCCGTGTGGTCACAGTAGGTGAGAGAAATG
CAAATCAAACCAGTTGAAATGGACACTATCCTGCCCTTAT
TATACACATACTTCATAATATAGCGCACCATAGAGGATAT
CTTCAGCCTGGCTGTTTCAAAATCACAAAAATATGGACAG
CATAATGATATATTTACATGATTATTACGCTACAGGGCGG
TGGGAGAGTTTCTGAACAGATTCTTTATTAACCAAAACAA
GCATTGCTGGCTTTCGGCTTCACTGTGTTTCTTTTTTTAT
TGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations