Transcript

snx4-002

ID
ZDB-TSCRIPT-090929-9063
Name
snx4-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026386 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026386|OTTDARG00000020922|ZDB-GENE-030131-1923 snx4|no_translation snx4-002 LG_ BX255930.3 Danio rerio protein_coding KNOWN, 576 bp
CAAGCTGTTATAACAGTAAGGTTAATCTGAAATGTTCTAG
AAACTCCCACAGGCTGATTAAGTTACTCACATGCAACTTT
TTTCTAACACAAACCCCCATCTGGTTTTCTGAAAGTGATC
AAACTGCAGGTCATCTACATTAGGTCTTCAGTTTAACAAT
TCCCGTAACATACAAACATCTTTATTTGTTTAATGGTCAA
TTTTTGTATATTTTGTGTGTGTGTGTACTTTGACAGGGCA
GTGTGTAGGAAGCATGAACTGACTCAGTATGAACTGGAGA
CAGCCGTCCAGGATCTGAGCTCTAAGAAACAGCAGCGGGA
GGAACTCGCCACCGGGACGGTCCGGACCTTCTCTCTGAAG
GGAATGACCAGTAAACTGTTTGGACAAGAGACCCCAGAGC
AGAGAGAGGCCAAGCTGAAAATGCTGGAGACACAGATTGA
AGAAGGAGAGGAAATGGTCAAAGACAGAAATGTAGAATGC
GAGTAAGCTCTGCACTATACTCTCAGCTGATTAAATAGGT
TTTTGCAGACAGCAACAGAAGACATGATATCGCAGACCAT
GCTTTCTGTTGCTGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations